
- Select a language for the TTS:
- UK English Female
- UK English Male
- US English Female
- US English Male
- Australian Female
- Australian Male
- Language selected: (auto detect) - EN
Play all audios:
ABSTRACT Community-acquired pneumonia (CAP) is a worldwide leading cause of death. Recognized risk factors in some severe cases have not been identified. Lymphocytopenia has been frequently
described in CAP. Since IL-7, membrane-bound receptor (IL7Rα;CD127) and soluble IL7Rα (sIL7R) are critical in lymphocytes homeostasis, in this work we aimed to evaluate the involvement of
the IL-7/IL7Rα axis in the severity of adult CAP, since it has not been explored. The _IL7R_α SNPs rs6897932, rs987106, and rs3194051 SNPs in _IL7_α were genotyped, the systemic expression
of the _IL7R_ gene, sIL7R, IL-7, and levels of peripheral IL7Rα+ T lymphocytes were quantified in 202 hospitalized CAP cases. rs3194051GG was more frequent in non-survivors than in
survivors; rs987106TT was more frequent and rs3194051AA less frequent in patients at intensive care unit (ICU) than in those not admitted to ICU. IL7Rα gene expression was lower in
non-survivors than in survivors, and in severe than in mild cases. CD3+CD127+ lymphocytes were lower in severe than in mild cases; in non-survivors than in survivors and in ICU than in non-
ICU admitted cases. sIL7Rα plasmatic levels were higher in non-survivors than in survivors, and in severe than in mild cases. rs6897932CC, rs987106AA and rs3194051GG carriers showed the
highest while rs6897932TT showed the lowest sIL7Rα levels. The AUC of sIL7Rα levels predicting 30-day mortality was 0.71. Plasma IL-7 levels were lower in ICU-admitted than in not
ICU-admitted and in non-survivors than in survivors. No additional association was detected. In conclusion, rs3194051GG and rs987106TT IL7R genotypes were associated with a poorer prognosis.
A significant association between sIL7R levels and SNPs of the IL7R gene is described for the first time in adult CAP. Increased plasmatic sIL7R could contribute to identifying adult CAP
cases at risk of death. SIMILAR CONTENT BEING VIEWED BY OTHERS INCREASED INTERLEUKIN-6 AND MACROPHAGE CHEMOATTRACTANT PROTEIN-1 ARE ASSOCIATED WITH RESPIRATORY FAILURE IN COVID-19 Article
Open access 10 December 2020 THE COMMON GENETIC VARIANT RS1278960 DETERMINING EXPRESSION OF _INTERFERON_-LAMBDA PREDICTS INFLAMMATORY RESPONSE IN CRITICALLY ILL COVID-19 PATIENTS Article
Open access 06 May 2025 THE INHIBITION OF IL-2/IL-2R GIVES RISE TO CD8+ T CELL AND LYMPHOCYTE DECREASE THROUGH JAK1-STAT5 IN CRITICAL PATIENTS WITH COVID-19 PNEUMONIA Article Open access 08
June 2020 INTRODUCTION Community-acquired pneumonia (CAP) is a frequent worldwide cause of death1. In Chile, CAP is the seventh cause of death, particularly among the elderly2. Some CAP
patients need to be admitted to intensive care unit (ICU) (10–20%)1, and some will die (5–10%)2. Advanced age and comorbidities (e.g. liver damage, cardiac insufficiency) are known risk
factors which are included in clinical scores of severity such as the Pneumonia Severity Index (PSI) and CURB-651,3. However, these factors are not detected in some severe cases, and
patients are wrongly classified4. A better understanding of the pathogenic factors is crucial to develop early biomarkers which could improve evaluation of severity risk at admission. The
immune response is substantial in the control and recovery of the infection. Lymphocytopenia has been described in CAP, probably related to T-cells and T-cell subsets5, and it has even been
proposed as a predictive marker4. In CAP patients, it is hypothesized that depression of absolute peripheral blood T-cell counts represents the transfer of these cells towards the lung in
order to be sequestered by protective mechanisms5. However, other factors could also be relevant. Interleukin 7 (IL-7) plays a critical role in the homeostasis of the immune system, leading
to the differentiation, proliferation, and survival of B, T, and natural killer (NK) cells6. In addition, patients with mutations in the extracellular domain of IL-7 receptor (IL7Rα or
CD127) have severe combined immunodeficiency (SCID) of the T−B+NK+ cells and suffer recurrent and severe respiratory bacterial and viral infections from the early infancy7. IL-7 is
constitutively produced and released by specialized non-hematopoietic cells from the thymus stroma, bone marrow, liver, spleen, and kidneys8. It is locally bound to heparan sulfate
proteoglycans, either on the surface of stromal cells or in the extracellular matrix; consequently, levels of IL-7 in human plasma are low, exhibiting values < 10 pg/ml in healthy
adults9,10. This cytokine interacts with its unique α-receptor membrane-bound IL7R, forms a ternary complex with common γc receptor and trigger a signaling cascade which facilitates target
gene transcription related with anti-apoptotic bcl-2 family9. IL7Rα is expressed on the lymphoid lineage and is required during early stage of T cell development and for proliferation and
survival of T cells in the periphery7. In addition, a soluble IL7Rα (sIL7R or sCD127) is generated for alternative splicing, which provides a modulatory control mechanism regulating
extracellular bioavailability of IL-76,10. Genetic variation in and the expression of the _IL7R_ gene, as well as increased expression of receptor/ligand genes, contribute to the
pathogenesis of autoimmune and chronic inflammatory diseases such as type 1 diabetes and multiple sclerosis7. Single-nucleotide polymorphism (SNP) of _IL7R_ gene, such as rs6897932,
rs3194051 and rs987106, has been associated with clinical severity in multiple sclerosis, hepatitis C and human immunodeficiency virus infection11,12,13,14. Four common haplotypes of the
_IL7R_ gene have been described in exonic and intronic zones and found to be associated with differential levels of sIL7R. This isoform is produced by alternative splicing of the preRNAm
that excludes exon 6 (encoding for the transmembrane domain) and generates a stop codon in exon-8 and a soluble protein12. Changes in IL-7 bioavailability due to decreased expression of the
membrane isoform of IL7Rα and increased soluble isoform levels have been proposed10. In addition, high plasma levels of this cytokine have been associated with lethality in sepsis15. Recent
studies support a critical role for IL-7 and its receptor in immunosenescence, and while low expression of the IL7Rα in the elderly was associated with a better metabolic profile, higher
expression of IL7Rα was linked with protection from mortality6. Since age is a known risk factor of CAP severity and the expression of IL7Rα decreases with age, but not IL-7 levels6, it is
relevant to explore these parameters in adults with CAP. Moreover, since IL-7 therapy could enhance and broaden the immune responses it could be used as severity biomarkers. The aim of this
study was evaluate the association of the components of IL-7/IL7Rα axis with clinical severity in adults with CAP, assessing the allelic and genotypic frequency of certain SNPs, expression
of the _IL7R_ gene, plasma concentration of soluble IL7R, IL-7 and the proportion of lymphocytes with membrane bound IL7R. METHODS PATIENTS AND STUDY DESIGN In this cross-sectional study,
202 patients aged ≥ 18 years old hospitalized for CAP were enrolled in three hospitals (Clínico Universidad de Chile, de Infecciosos Dr. Lucio Córdova Hospital, and Complejo Hospitalario San
José) in Santiago, Chile from May 2017 to August 2019. CAP was defined as the presence of acute respiratory symptoms for less than one week plus a chest X-ray display new pulmonary
infiltrates2,4. Patients with immunocompromising conditions (i.e., organ transplant, active treatment for cancer, human immunodeficiency virus infection, immunosuppressive and, or steroids
therapy), hemodialysis and hospitalizations within 30 days preceding enrollment were excluded. Clinical and epidemiological data of the all patients were obtained from medical records,
including age, sex, comorbidities (i.e., hypertension; diabetes mellitus; chronic obstructive respiratory disease; chronic liver disease (chronic liver damage suggested by abdominal
ultrasound imaging and/or computed tomography scan); chronic kidney damage (serum creatinine level ≥ 2 mg/dL); cardiac insufficiency (heart failure with reduced ejection fraction (≤ 45%));
neurologic disease (nervous system disorders including epilepsy, Parkinson's Disease, Alzheimer's Disease, and stroke); smoking; alcohol consumption (> 80 g per day yes/no);
clinical presentation (fever, respiratory symptoms); chest radiographic patterns (consolidation and pleural effusion), and laboratory parameters (i.e., hemogram, plasmatic concentration of
glucose, sodium and blood urea nitrogen). The severity of patients was evaluated according to PSI3 and CURB-651 clinical scores applied during the first 48 h after enrollment: IV and V
groups of PSI and ≥ 3 of CURB-65 score were considered as severe, while I and II groups of PSI and ≤ 2 of CURB-65 score were considered as mild. Several outcome variables were analyzed:
death up to 30 days post- discharge, admission to ICU, use of mechanical ventilation (MV), and supplemental oxygen therapy. Basal values of different parameters were determined in 22
asymptomatic adults without respiratory infection at least 45 days before enrollment and with no pathogen detected in microbiological screening. The study was approved by the Committee on
Research in Human Beings of Faculty of Medicine, University of Chile; the Ethics Committee of Clínico U. Chile Hospital, and the Ethics Committees of the South and North Metropolitan Health
Service. Written informed consent was provided by all patients at enrolment. The study was performed in accordance with the principles of the Declaration of Helsinki. MICROBIOLOGICAL STUDY
An immunochromatographic test (Binax NOW, Portland, Oregon, USA) was used to detect _Streptococcus pneumoniae_ and _L. pneumophila_ serogroup 1 antigens in urine. For the detection of other
respiratory pathogens, total genetic material was extracted from nasopharyngeal aspirate/swabs samples (300 µL) by Favorprep™ Viral Nucleic Acid Extraction kit (Favorgen®), according to
manufacturer’s instructions, and after was quantified in an EPOCH® spectrophotometer. Human respiratory viruses such as respiratory syncytial virus, influenza A and B viruses, adenovirus,
metapneumovirus, bocavirus, coronavirus (HCoV 229E; HCoV OC43, HCoV-NL63, and HCoV-HKU1), parainfluenza virus, rhinovirus/enterovirus, and bacterias (_Chlamydophila pneumonia_e, _Mycoplasma
pneumoniae_ and _Legionella pneumophila)_ were detected by Respiratory Multi well system r-gene Real Time RT-PCR kit Argene®, according to the manufacturer’s instructions in a MIC®
thermocycler (BMS®). SNPS GENOTYPING Three single nucleotide polymorphisms located at the _IL7R_ gene were evaluated: rs987106 in an intronic region (c.801-21 A > T), rs6897932 in exon 6
(transmembrane region; c.731 C > T; p.Thr244Ile), and rs3194051 in exon 8 (intracellular region; c.1066 A > G; p.Ile356Val). Only Chilean people were studied. This population is over
90% admixture Caucasian and South amerindian people16. EXTRACTION OF GENOMIC DNA Genomic DNA was extracted from venous blood (250 μl) with EDTA as anticoagulant using Exgene™ Blood SV kit
(GeneAll®) according to the manufacturer instruction. All extracted DNA samples were treated with RNase A (Thermo Scientific, USA) and quantified by spectrophotometry (Epoch (BioTek®).
Aliquots (5 ng/μl) were prepared and stored at −20 °C. PRIMERS DESIGN Primer sets for the amplifications were designed based on the sequence NG_009567.1 using the software Beacon Designer
8.02 (PREMIER Biosoft, int). The specificity of primers was confirmed on Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast). The primer set for each SNP were: rs6897932: HD:
CCACAATCTATTCTTGCTTTCCA and HR: 5´-CCAACAGAGCGACAGAGA-3´; rs987106: 801A-PH: 5´-CTGCCATTCACTTCATCTAT-3´, 801 T-PH: 5´-CTGCCATTCACTTCATCTTT-3´ and 801-PR: 5´-ATGTTCCAGAGTCTTCTTATG-3´;
rs3194051: HD: 5´-AACTGCCCATCTGAGGAT-3´ and HR: 5´-GCATGTGAGGGATGAATCT-3´. PCR AMPLIFICATION AND GENOTYPING SNPs were independently analyzed. rs6897932 and rs3194051 SNPs were genotyped
using in-house PCR-HRM assay validated by direct sequencing. The PCR-HRM reaction was prepared in a final volume (10 μL) which includes DNA template (10 ng), KAPA HRM FAST Master Mix (5 μl)
(KAPA HRM FAST kit; Kapabiosystems©), MgCl2 (2.5 mM) and each primer set (0.25 μM). Amplifications were performed in an ECO™ Real-Time PCR System Thermocycler (Illumina®). PCR amplifications
were performed with initial denaturing at 95 °C for 2 min, and subsequently subjected to 45 cycles: 95 °C for 5 s (denaturalization), 56 °C for 15 s to rs6897932 or 55 °C for 20 s to
rs3194051 (annealing and extension). After PCR amplification, the HRM was carried out over the range 55–95 °C rising at 0.1 °C/s. The genotype of each sample was determined by Eco software
4.1.02.0. Allele-specific PCR was applied for genotyping SNP rs987106, using a specific forward primer to each allele (A or T) and a common reverse primer as described above in “Primer
design”. Two reactions were performed for each sample. Final volume (10 μl) was prepared with DNA template (10 ng), KAPA SYBR FAST Master Mix (5 μl) (KAPA SYBR FAST kit; Kapabiosystems©),
and each primer set (0.2 μM) in an ECO™ Real-Time PCR System Thermocycler (Illumina®). PCR amplification was performed at 95 °C for 2 min, and 45 cycles: 95 °C for 5 s, 61 °C for 15 s and 72
°C for 3 s. IL7R EXPRESSION BY RT-QPCR Blood samples were centrifuged at 2000 rpm for 5 min, and the RNA was extracted in 800 μl of the precipitate with TRIzol™ reagent (Invitrogen, Thermo
Fisher Scientific), according to the manufacturer instructions. Extracted RNA was treated with TURBO DNA-free™ kit (Ambion®, Life Technologies) and its concentration was determined by
spectrophotometry (Epoch®, Biotek Instruments). Relative gene expression was determined by real time RT-PCR assay based on SYBR-Green detection. _TUBB_ was used as gene for normalization17.
cDNAs were obtained from 2 µg RNA using M-MLV Reverse Transcriptase (Promega®) and random primers (Promega®), according to the manufacturer’s guidelines. Primers to _IL7R_ mRNA were designed
using the Genbank sequence NM_002185.4 and the software Beacon Designer 8.02 (PREMIER Biosoft®) (F: 5’-CAGCAATGTATGAGATTA-3’; R: 5’-ATGGTTAGTAAGATAGGAT-3’). The PCR reaction was performed
using the KAPA SYBR© Fast qPCR (Kapa Biosystems®) with cDNA (2 µl) in a final volume (10 µl), according to the Eco™ Real-Time PCR system (Illumina®) protocol. PCR amplification was performed
at 95 °C for 3 min, and 45 cycles: 95 °C for 3 s, 53 °C for 15 s and 72 °C for 3 s followed by the melting curve (55–95 °C). Gene expression fold changes (FC) were determined using the
2−ΔΔCTmethod18. The group used as control is indicated in each analysis. QUANTIFICATION OF MEMBRANE BOUND IL7RΑ (CD127) EXPRESSION ON T CELLS AND OF PERIPHERAL T LYMPHOCYTES BY FLOW
CYTOMETRY Blood samples were collected in EDTA tubes. Peripheral blood leukocytes were isolated by centrifugation (Boeco® Centrífuge) and stained with BD Horizon Brilliant Stain Buffer
(563794 BD Pharmigen™) and BD Pharmigen Stain Buffer (FBS) (554656 BD Pharmigen™). Cells were incubated with specific antibodies, and later with 1× BD FACS Lysing Solution (641776 BD
Pharmigen™). For the surface staining of peripheral blood mononuclear cells (1 × 106), the followings antibodies of BD Pharmigen™ were used: APC mouse anti-human CD3 (555342), PerCPCy5.5
mouse anti-human CD4 (341654), FITC mouse anti-human CD8 (555634) and BV421 mouse anti-human CD127 (562436). Isotype-matched controls were used in all experiments: APC mouse IgG2a (555576),
PerCPCy5.5 mouse IgG1 (550795), FITC mouse IgG1 (555748) and BV421 mouse IgG1 (562438). Dead cells were excluded by BD Horizon™ Fixable Viability Stain 780 (565388). Samples were acquired on
the FACSCANTO™ II (BD Biosciences©). The data were analyzed using the FlowJo10.4® software. QUANTIFICATION OF SOLUBLE IL7R (SIL7R) BY ELISA Soluble IL7Rα in plasma was measured using Human
IL-7 alpha ELISA (RayBiotech®) following manufacturer's instruction. QUANTIFICATION OF CYTOKINES BY LUMINEX© TECHNOLOGY Plasma IL-7 was quantified by HCYTOMAG-60K kit (Milliplex MAP
human cytokine/chemokine magnetic bead panel, MERCK®). The assay was run on MAGPIX® (Luminex©) with xPONENT software. Data were analyzed using a five-parameter logistic curve with Milliplex
analyst software. STATISTICAL ANALYSIS Continuous variables were described as median and interquartile range (IQR) and categorical variables as frequency and percentage. Differences between
groups were performed using the Chi square test for categorical data, and Student´s t and Mann–Whitney test for continuous variables, as appropriate. Parameters were compared according to
predictor variables age, sex, and comorbidities. Days of illness were also analyzed in some parameters—as indicated in “Results”—because the immune response is dynamic over time. The area
under the receiver operating characteristic curve (AUC) for predicting 30-day mortality and admission to ICU was calculated for plasmatic sIL7Rα. The association for each SNP of the _IL7R_
with severity score and clinical outcomes (supplemental oxygen therapy, days of illness, ICU admission and death) in adults with CAP was evaluated through logistic regression model: crude
(model 1), adjusted by age and sex (model 2) and adjusted by age, sex, and severity score (model 3). Odds ratios (ORs) and respective 95% confidence interval (CI) were reported as measure of
associations. Hardy–Weinberg equilibrium of each SNP and association studies were tested using Armitage’s trend test (http://ihg.gsf.de/cgi-bin/hw/hwa1.pl). Alleles, genotypes and haplotype
analysis were carried out with the Unphased 3.1.5 software19, as previously described19. Statistical significance was set at P value < 0.05. Data were analyzed using Stata 16.0,
GraphPrism 8.4.2, and SPSS V25.0 software. ETHICS APPROVAL AND CONSENT TO PARTICIPATE The study was approved by the Ethics committees at the Clínico Universidad de Chile Hospital (Act N12),
the Universidad de Chile Facultad de Medicina (Act N009), and the South Metropolitan Health Service (Act N 142/2017). Written informed consent was obtained from each participant. RESULTS
CHARACTERISTICS OF STUDIED POPULATION Table 1 shows the general characteristics of 202 patients hospitalized with CAP. The clinical outcome was mechanical ventilation in 41 (20.3%) cases,
and shock in 22 (10.9%) patients. Severe cases and comorbidities were more frequent in older patients (≥ 65 years) than in younger patients (p ≤ 0.02). The characteristics of the 100 women
and 102 men were similar, except for higher frequency of asthmatics and mild cases (by PSI) in female than in male patients (13% vs 5%, p = 0.04; 30% vs 18%, p = 0.04) (see Supplementary
Table 1 online). Respiratory pathogens were detected in 123 (61%) of 202 cases (Table 1). Viruses most frequently detected among 91 patients with viral detection were: influenza (37/91
cases; 40.7%) and rhinovirus (27 cases, 29.7%), and _S.pneumoniae_ was the most frequently detected bacteria, in 42/55 cases (76.4%). The median age of 22 asymptomatic adults without
respiratory infection was 54.0 years (IQR: 43–63); 7 (36.8%) were men; 3 (15.8%) have co-morbidities (one type 2 Diabetes Mellitus, one asthma and one hypothyroidism); one was smoker (4.8%)
and no one had alcohol consumption > 80 g/day. _IL7RΑ_ GENETIC VARIANTS ALLELIC AND GENOTYPIC FREQUENCIES Several SNPs in the _IL7Rα_ gene have been associated with immune and infectious
diseases. In this study, three SNPS—rs6897932 (c.731-C > T), rs987106 (c.801–21-A > T) and rs3194051 (c.1066-A > G)—and their association with the severity of CAP were explored.
Carriers of the rs987106TT and the rs3194051AG genotypes were more frequent in patients hospitalized in ICU (Table 2). The G allele in this last SNP is a risk allele according to Armitage’s
test for association studies, with an odds ratio of 2.97 (p = 0.0003) between ICU-no ICU groups and of 2.52 with respect to the A allele between severe/mild cases according to PSI (p =
0.004). In addition, the rs3194051GG genotype was also more frequent in non-survivors than in survivor patients (Table 2). No differences were identified in the SNP rs6897932, except a
higher number of carriers of the C allele and CC genotype among severe than in mild patients according to CURB-65. On the other hand, carriers of the rs3194051 AA genotype were significantly
more frequent in patients who did not were admitted to the ICU (Table 2). Multivariable logistic regression models were performed to assess if the genotype GG of rs3194051 was associated
with the severity of illness compared to the other genotypes (GA, AA, or any of them (AA/GA)). rs3194051GG had a significant positive relationship with admission to ICU even in models
adjusted by age, sex, and severity (Table 3). rs3194051GG was also positively associated with dead in relation to any of other genotypes in adjusted models by age and sex, but it did not
reach statistical significance when severity was included in the model. These analyzes were not possible with the PSI score because of the small sample size. According to age and sex,
carriers of the C allele and CC genotype in the rs6897932 and the A allele in the rs987106 were significantly more frequent in older than in younger patients. This difference remained
significant among men, but not among women (see Supplementary Table 2 online). In addition, the rs6897932CC and rs987106AA genotypes were more frequent in females than in males, but only in
< 65 years patients. No differences were detected in the SNP rs3194051. _IL7R_ HAPLOTYPES The association between the haplotypes in the three SNPs of the _IL7Rα_ gene and CAP severity was
studied. The CAA allelic combination (rs6897932—rs987106—rs3194051) was less frequent in patients admitted to the ICU; the CTA haplotype was associated with dead and the CTG haplotype with
admission at ICU (Table 4). The TTA haplotype was associated with mild illness, but only when CURB-65 score is applied. Since age and comorbidities are factors associated to severity also
were analyzed. Certain haplotypes were associated with any comorbidities and CAA allelic combination was more frequent in adults over 65 years (Table 4). Analysis of the genotypes of all the
SNPs studied showed that the CC-TT-AG combination was significantly more frequent in severe cases than in mild cases, and the CC-TT-GG genotype in the severe by CURB-65 and non-survivors
patients (Table 5). So, G allele in the SNP rs3194051 is associated with severity of the CAP in adults. _IL7RΑ_ GENE EXPRESSION _IL7Rα_ gene expression was lower in 13 non-survivors adults
than in 112 survivors with CAP (FC: 0.26 vs 1.0; p = 0.01), but similar between 22 patients in ICU and 107 cases without admission to ICU (p = 0.6). According to severity of CAP defined by
clinical scores, gene expression was lower in 57 severe cases than in 39 mild cases by PSI (FC: 0.27; p = 0.009), but similar between cases classified by CURB-65. In relation to genotypes of
the SNPs studied, expression of _IL7Rα_ gene was significantly lower in 58 carriers of the CT genotype than in 54 carriers of the CC genotype of the rs6897932 (FC: 0.28; p = 0.01). Although
differences were not statistically significant, expression was lower in 66 carriers of the AT and 28 of the TT genotypes than in 35 carriers of the AA genotype in the rs987106 (FC: 0.33 and
0.25, respectively) (p > 0.1) and higher in 30 carriers of the AG genotype than in 97 carriers of the AA genotype in the rs3194051 (FC: 1.79; p = 0.5). _IL7Rα_ gene expression was lower
in 81 adults over 65 years old with CAP than in 48 adults < 65 years (FC: 0.55 vs 1.0, respectively), and was higher in 62 men than in 67 women (FC: 2.31 vs 1.0, respectively), although a
statistical significance was not gotten. No differences were found comparing days of illness or pathogen detected. PROPORTION OF CD3+ LYMPHOCYTES Given the connection between IL7R axis and
T lymphocytes, these subpopulations were studied in 68 CAP and in 15 asymptomatic adults by flow cytometry. Proportion of the CD3+ lymphocytes was significantly lower in patients (median:
45.3% vs 55.1% [IQR: 31.8–59.58 and 46.5–66.5]) (Fig. 1A), and in adults ≥ 65 years old than in < 65 years old (median: 41.4% vs 54.3% [IQR: 30.5–54.5 and 39.9–65.9]) (p = 0.03),
difference that remained statistically significant only in women (median: 45.1% vs 62.9% [IQR: 31.8–60.6 and 53.4–66.5]( (p = 0.007) (Fig. 1B). Also CD3+TL was lower in non-survivors
patients than in survivors (median: 35.3% vs 46.6% [IQR: 29.9–48.2 and 35.2–60.8; p = 0.1), but statistical significance was not reached. CD3+ lymphocytes proportion was lower in severe
patients than in mild cases according to PSI (median: 39.9% vs 59.0% [IQR: 30.3–58.6 and 50.1–66.5]; p = 0.04) (Fig. 1C), and similar by CURB-65 (median: 49.9% vs 50.4% [IQR: 30.4–59.6 and
36.0–63; p = 0.2). EXPRESSION OF MEMBRANE-BOUND IL7RΑ (CD127) ON T LYMPHOCYTES T lymphocytes expressing α-receptor membrane-bound IL7Rα (CD127) were studied by flow cytometry. Significantly
lower proportion of the CD3+CD127+ lymphocytes was recorded in patients as compared to asymptomatic adults (median: 30.5% vs 37.5% % [IQR: 22.4–37.8 and 32.0–52.7]; p = 0.01) (Fig. 2A).
Similarly, the proportion was significantly lower in severe patients than in mild cases classified by both PSI (median: 25.6% vs 49.1% [IQR: 21.7–35.3 and 37.1–54.7]) and CURB-65 (25.0% vs
36.4% [IQR: 18.3–36.4 and 23.4–51.5]) (p ≤ 0.02). Although statistical significance was not reached, CD3+CD127+ lymphocytes also were lower in non-survivors patients than in the survivors
(median: 24.8% vs 32.6% % [IQR: 21.0–32.3 and 22.5–40.6]; p = 0.2) (Fig. 2B). Significantly lower proportion of the CD3+CD127+ lymphocytes was recorded in older than in younger patients
(median: 25.4% vs 39.4% [IQR: 21.1–34.9 and 31.4–51.5]; p = 0.0009), being also significant among women (median: 24.8% vs 47.6% [IQR: 20.0–32.2 and 40.7–55.8]; p < 0.0001) (Fig. 2C).
There were no significant differences according to genotypes (Fig. 3A–C) (rs3194051GG was excluded because only one patient could be analyzed) nor pathogen detected: 40 viral cases (median:
32.0% [IQR: 23.6–37.2]) and 62 patients with bacterial detection (24.6% [IQR: 16.2–39.7]) (p = 0.4). The mean fluorescence intensity of CD3+CD127+ lymphocytes was determined as an estimate
of the number of receptors per cell, being significantly higher in the 11 non-survivors patients than in the 56 survivors (median: 5599 vs 3377 [IQR: 3741–7076 and 2624–4482]; p = 0.001). No
differences were detected between 15 patients in ICU and 48 without admission to ICU (median: 3269 vs 3688 [IQR: 2401–3838 and 2918–5594]; p = 0.1); between 45 severe patients and 10 mild
cases according to PSI (median: 3563 vs 3085 [IQR: 2890–4848 and 2371–4212]; p = 0.2); between 32 severe patients and 36 mild cases according to CURB-65 (median: 3593 vs 3367 [IQR: 2886–5355
and 2684–4736]; p = 0.3) and between 18 older adults and 50 younger (median: 3369 vs 3557 [IQR: 2565–4695 and 2892–4874]; p = 0.5). Although expression of membrane bound IL7Rα (CD127) in
CD4+ and CD8+ T cells was quantified in few patients, a significant lower proportion of CD4+CD127+ cells, but no of CD8+CD127+ cells, were detected in severe cases as compared to mild cases
classified by PSI (Fig. 4A,B). QUANTIFICATION OF SOLUBLE IL7R Soluble IL7R (sIL7R) is associated with the homeostasis of the IL-7/IL7R axis. In this study, plasmatic levels of sIL7Rα were
higher in asymptomatic adults than in adults with CAP, although statistical significance was not developed (median: 26.3 vs 22.4 ng/ml [IQR: 23.8–38.1 and 15.2–33.4; p = 0.09) (Fig. 5A).
Also levels of sIL7R were significantly higher in adults ≥ 65 years than in patients < 65 years (median: 24.6 vs 17.5 [IQR: 16.9–35.0 and 11.8–25.4]; p = 0.001) (Fig. 5B). The
non-survivors patients showed significantly higher sIL7R concentrations than the survivors (median: 30.4 vs 20.9 ng/ml [IQR: 21.6–46.4 and 14.4–29.3]; p = 0.0003). The same happened in the
severe cases with respect to mild cases according to PSI (median: 25.7 vs 17.1 [IQR: 16.2–38.2 and 12.8–22.5]; p = 0.0008) and CURB-65 (median: 27.9 vs 17.5 [IQR: 21.2–40.4 and 13.4–24.5]; p
< 0.0001) (Fig. 5C). sIL7R also was higher in the 29 patients with mechanical ventilation than in 124 without MV, but the difference was not significant (median: 29.4 ng/ml vs 21.39
ng/ml; p = 0.05). Significant differences in levels of sIL7R were detected in the patients according to the genotypes of the three SNP studied. Thus, the highest levels were detected in
carriers of rs6897932CC, rs987106AA, and rs3194051AA genotypes; while the lowest concentrations were observed in adults with rs987106TT, rs3194051AA genotypes, and the lowest of all, the
rs6897932TT carriers (Fig. 6). An evaluation of the predictive capacity of the plasmatic sIL7R levels was performed by an area-under-the curve (AUC) analysis. AUC was 0.71 (SE 0.05; 95% CI:
0.60–0.81) for prediction of 30-day mortality and 0.48 (SE 0.06; 95% CI: 0.36–0.60) for admission at ICU. Regarding sIL7R values, the best threshold calculated on the basis of minimum d
(minimum distance between ROC curve and point of sensitivity and specificity = 1) was 25.04 ng/ml. For this cutoff value, sensitivity was 73.3%, specificity was 66.1%, 67.6% was classified
correctly, LR ( +) was 2.1642 and LR (−) was 0.4033. Among 113 CAP adults with sIL7R levels above 25.04 ng/ml, 85 (75.2%) were ≥ 65 years, 30 (26.5%) were admitted to ICU, 75 (66.4%) were
classified as severe by PSI and 50 (44.2%) by CURB-65 and, whereas only 53 (59.6%), 8 (8.98%), 35 (39.3%) and 18 (20.2%) were in the 89 cases with levels below this cut-off value,
respectively (p < 0.02). Moreover, to determine whether plasma concentrations of the sIL7R correlate with the level of membrane-bound receptor expression on T cells (CD3+CD127+
lymphocytes), ratio of membrane to soluble receptor was evaluated, being significantly lower in severe than in mild cases by both PSI and CURB-65, and in adults ≥ 65 years than in adults
< 65 years. Although not statistically significant, ratio was also lower in non-survivors than in survivor patients and in cases in ICU than in without admission to ICU (Table 6).
Although the linear regression model showed no relationship between sIL7R concentration and days of illness (coefficient −0.02; 95% CI: −0.06 to 0.014; p = 0.29), given sIL7R levels were
significantly higher in 95 patients with less 7 days of illness than in 57 cases with > 7 days (median: 23.8 vs 19.4 ng/ml; p = 0.03), the analyses were repeated excluding the latter
cases. Significant differences remained in all comparisons previously shown, except in higher levels of sIL7R between carriers of AG vs AA and GG vs AA genotypes in the rs3194051. On the
contrary, the greatest levels of sIL7R in carriers of CC vs CT genotypes in the rs6897932 and AA vs AT genotypes in the rs987106 achieved statistical significance (see Supplementary Table 3
online). CONCENTRATION OF IL-7 Since IL-7 activates its receptor and plays a transcendental role in T cell homeostasis, IL-7 levels were evaluated. Significantly higher levels of plasmatic
cytokine IL-7 were detected in adults with CAP than in asymptomatic adults. Levels were lower in patients in ICU, with oxygen therapy and in the non-survivors patients, although the last
difference was not statistically significant (Table 7). No significant differences were detected in IL-7 levels by gender, age, or severity according to both clinical scores (Table 7), or by
genotypes either (see Supplementary Table 4 online). No correlation between plasmatic IL-7 and sIL7R concentrations was found in 123 CAP cases studied (Spearman’s rank correlation
coefficients, r = −0.11; 95% IC: −0.2895 to 0.07025; p = 0.21); not with LTCD3+ (r = 0.11; 95% IC:−0.1433 to 0.3543; p = 0.3); CD127+ (r = 0.10; 95% IC: −0.1546 to 0.3576; p = 0.40), or age
either (r = −0.0663; p = 0.3). According to pathogen detected, IL-7 level was lower in 26 patients with bacteria than in 57 viral cases (median: 3.6 vs 5.3 pg/ml [IQR: 1.8–5.3 and 3.4–7.6];
p = 0.01), while both viral and bacterial cases were similar to 19 patients with mixed infections (median: 4.3 pg/ml [IRQ: 1.8–9.6]; p > 0.4). DISCUSSION To the best of our knowledge,
this is the first study of the genic/protein expression IL-7/IL7R axis in adults with CAP, looking for a new potential severity factor. High plasmatic levels of soluble receptor IL-7 (sIL7R)
and two IL7R gene polymorphisms studied were associated to CAP severity. Thus, the non-survivors patients had higher plasmatic levels of sIL7R than the recovered patients, as well as
non-significant lower levels of both the genic expression of IL7R and IL-7, and of circulating CD3+TL and CD3+CD127+TL. These results agree with previous reports on the regulatory role of
sIL7R in the capture of IL-76. Its increase produces a diminishing of the circulating IL-7 level, which interacts with the lymphocyte’s membrane receptor, determining lymphopenia. The
increase in membrane receptor levels could be due to attempts to compensate for the decrease in IL7. CD4+127+ more than CD8+127 T lymphocytes were affected, which is very important given the
essential role of these cells in the immune response. The significant relationship between high sIL7R levels and lethality risk in CAP has also been described in patients suffering sepsis,
where cases with lower sIL7R have better outcomes, proposing its use as a risk biomarker20. Actually, in our study those cases with fatal sepsis had higher levels of sIL7R than those
recovered (medians: 30.8 vs 19.7 ng/ml; p = 0.01) and the increased sIL7R levels persisted when the case severity was defined by other parameters, such as ICU admission, PSI and CURB-65
severity scores. AUC of sIL7R for fatality was similar to those Score index (AUC = 0.71), being similar to the obtained in septic cases (AUC: 0.774- 0.846). Furthermore, it is interesting to
outstand that cases classified as moderated by PSI and CURB-65 had sIL7R levels similar to severe cases and also over the mild cases levels, (median: 22.41, 25.76 and 17.18 ng/ml,
respectively), suggesting that those cases should have been managed as severe ones; some of them were after admitted to ICU or passed on. In addition, two IL7R gene polymorphisms studied
were associated to CAP severity. rs3194051GG genotype carriers displayed five times more lethal outcomes than cases with no GG. These patients also predominated among the cases admitted to
UCI, as well as rs987106TT genotype carriers. GG genotype has been associated with autoimmune pathologies like type I diabetes21 and multiple sclerosis11, diseases that were not reported in
the cases studied. Both SNPs are located in a potential regulatory zone whose effects have not been defined14 and which it is different to those related to mutations observed in the combined
severe immunodeficiency, disease that is not present in the adults studied. The different production of sIL7R is the more noticeable effect of polymorphisms12,22. In this study, changes in
the sIL7R levels were detected in the three SNP according to the genotype. Thus, the plasmatic level was higher in rs3194051GG, rs987106AA and rs6897932CC genotypes, while the lowest was in
the carriers of rs6897932TT. It is striking that the highest levels are detected in the genotype associated with severe and fatal cases, while the lowest levels are identified in the
genotype TT, described previously as a protector for multiple sclerosis11, through of reduced exon splicing and production of soluble IL7R23,24. Although the plasmatic levels of sIL7R were
associated to genotypes, no association was observed between the genotypes and the expression of _IL7R_ gene in blood. This last result should be interpreted with caution by two limitations
of this study: first, the analyzed mRNA corresponded to the receptor attached to the membrane and not to the soluble one, and second because RNA is extracted from all blood cells, which does
not detect changes in expression in a certain cell type. Association between genotypes and receptor expression in the LT membrane was also not detected. It would be interesting to explore
whether this condition also occurs in other types of leukocytes such as monocytes. Recently, a key role of the latter cells has been raised in the biological pathway of diseases associated
with cytokine IL-7 and its receptors24. The highest proportion of severe cases and deaths detected among those over 65 is consistent with the risk of severity described in older adults. They
also had higher levels of sIL7R and lower percentage of CD127+ T lymphocytes in relation with the younger cases, which agree with the role of IL-7/IL7R axis in the immunosenescense6.
However, the _IL7R_ expression was not significantly diminished in older adults as it has been published25, and further studies are necessary. On the other side, since sIL7R levels are
increased over 65 years old and all the fatal cases were over that age, it could be argued that the high level was due to the age factor. However, among those over 65 years of age, sIL7R
levels were significantly lower in recovered than in non-survivors cases (median: 23.3 vs 33.2 ng/ml; p = 0.004). Therefore, the old age would not be the only cause of the high level of the
sIL7R. There were no gender differences, but some parameters showed differences when they were analyzed according to age. Thus, while the proportion of CD3+ and CD127+ T lymphocytes in
females was lower over 65 years old than in younger ages, the genotype rs987106CC in men was significantly more frequent in cases over 65 years old. There are no explanations for this fact
or its influence in the CAP outcome. Although the IL7/IL7R axis has been associated with certain autoimmune conditions like type 1 diabetes mellitus, rheumatoid arthritis and multiple
sclerosis26, the more frequent comorbidities in patients over 65 years old does not explain the higher sIL7R concentration detected. They represent other type of pathologies, mostly
cardiovascular and neurologic diseases, and no differences were observed in the levels of sIL7R between cases with and without these comorbidities. Therefore, the presence of comorbidities
would not interfere with the level of sIL7R as severity biomarker in adult CAP. Furthermore, its determination can be quantitatively performed with a routine technique such as ELISA, which
it can be easily implemented in clinical hospitals. Plasmatic concentrations of IL-7 had no variation in relation to severity conditions described or with genotypes or sIL7R plasmatic
levels, unlike that described in sepsis20. Probably, the SNP-associated mechanisms affecting IL-7 levels are more complex, and independent mechanisms of sIL7R regulate IL-7 levels23. This
needs to be resolved before implementing recombinant human IL7 therapy as proposed given severe CAP-associated lymphopenia27. There were no differences in sIL7R and IL-7 in relation to
pathogens detected. Just a higher IL-7 level in viral versus bacterial CAP was detected, probably explained by the role of IL-7 in promoting antiviral activity of T lymphocytes14. A limiting
condition of the study was the patient evaluation just one time, which impedes to have a dynamic vision of quantified parameters. However, only differences in sIL7R were detected according
to the time of evolution, being significantly lower in cases with over one week of evolution. No differences were seen in cases with more or less than 3 days of evolution, neither between 1
and 3 days as in sepsis20. Another limitation of the study could be the mixed analysis of patients with and without detected pathogen; however, the absence of differences in the demographic
and clinical characteristics, in the evolution and in the parameters studied between the two groups (data not shown) suggest that the results would not be affected by the detection of
pathogens. The results in our study explore alterations in the IL-7/sIL7R/mIL7R axis in adult community-acquired pneumonia. The aforementioned axis formulated in relation to autoimmune
diseases like multiple sclerosis, includes lower levels of sIL7R and augmented relationship of mIL7R/sIL7R26. For adult CAP with risk of severity we propose a pathogenic model characterized
by a pattern of a high level of sIL7R and a diminished IL-7 concentration, which tend to decrease T lymphocyte activity and therefore, the control of the infection. The development of new
biomarkers of severity could improve therapy of CAP in adults. In this study, parameters associated with severity were identified which, although currently have limited clinical application,
it is of interest to explore their usefulness in conjunction with other biomarkers, since the complexity of the pathogenesis of the neumonia, a panel of different biomarkers is probably
required, including genetic and immunological parameters. In conclusion, SNPs of IL7R would be related to the severity of adults with CAP, since unfavorable IL7R genotypes (rs987106 TT, and
rs3194051GG) had a worse prognosis. Our results constitute the first description of a significant association between sIL7R levels and SNPs in rs3194051, rs6897932 and rs987106 in adults
with CAP. The increase in plasma level of sIL7R can contribute to identify adults with CAP in risk of death. Their routine implementation and even automated quantification, by the ELISA
technique can be easily executed in hospitals. DATA AVAILABILITY All of the datasets in the current study are available from the corresponding author on reasonable request. ABBREVIATIONS *
CAP: Community acquired pneumonia * IL7Rα or CD127: Membrane-bound receptor interleukin 7 * sIL7R: Soluble receptor interleukin 7 * SNP: Single-nucleotide polymorphism * ICU: Intensive care
* PSI: Pneumonia Severity Index * CURB-65: Confusion, uremia, respiratory frequency, blood pressure, 65 years old * IL-7: Interleukin 7 * NK: Natural killer cells * SCID: Severe combined
immunodeficiency * RNAm: Messenger ribonucleic acid * HCoV: Human coronavirus * DNA: Deoxyribonucleic acid * PCR-HRM: Polymerase chain reaction-high resolution melting * RT-qPCR: Real time
reverse transcription-polymerase chain reaction * cDNA: Complementary deoxyribonucleic acid * ELISA: Enzyme-linked immunosorbent assay * FC: Fold changes * IQR: Interquartile range * AUC:
Area under the receiver operating characteristic curve * ORs: Odds ratios * CI: Confidence interval * COPD: Chronic obstructive pulmonary disease * LR: Likelihood ratios REFERENCES *
Morello, A., Furmanek, S., English, C., Ramirez, J. & Cavallazi, R. Predicting the need for ICU admission in community-acquired pneumonia. _Respir. Med._ 155, 61–65 (2019). Article
Google Scholar * MINSAL. Neumonía adquirida en la comunidad en adultos de 65 años y más. Manejo ambulatorio. _Ser. Guías Clín. Minsal_ 25, 1371 (2011). * Fine, M. J. _et al._ A prediction
rule to identify low-risk patients with community-acquired pneumonia. _N. Engl. J. Med._ 336, 243–250 (1997). Article CAS Google Scholar * Curbelo, J. _et al._ Inflammation biomarkers in
blood as mortality predictors in community-acquired pneumonia admitted patients: Importance of comparison with neutrophil count percentage or neutrophil-lymphocyte ratio. _PLoS ONE_ 12,
e0173947 (2017). Article Google Scholar * de Jager, C. P. C. _et al._ The neutrophil-lymphocyte count ratio in patients with community-acquired pneumonia. _PLoS ONE_ 7, e46561 (2012).
Article ADS CAS Google Scholar * Nguyen, V., Mendelsohn, A. & Larrick, J. Interleukin-7 and immunosenescence. _J. Immuno. Res._ 4807853 (2017). * Kumrah, R. _et al._ Genetics of
severe combined immunodeficiency. _Genes Dis._ 7, 52–61 (2020). Article CAS Google Scholar * Kielsen, K. _et al._ T cell reconstitution in allogeneic haematopoietic stem cell
transplantation: Prognostic significance of plasma interleukin-7. _Scand. J. Immunol._ 81, 72–80 (2015). Article CAS Google Scholar * Sasson, S., Zaunders, J. & Kelleher, A. The
IL-7/IL-7 receptor axis: Understanding its central role in T-cell homeostasis and the challenges facing its utilization as a novel therapy. _Curr. Drug Targets_ 7, 1571–1582 (2006). Article
CAS Google Scholar * Lundströma, W. _et al._ Soluble IL7Rα potentiates IL-7 bioactivity and promotes autoimmunity. _PNAS_ 110, E1761–E1770 (2013). Article Google Scholar * Al-Eitan,
L., Al Qudah, M. & Al Qawasmeh, M. Association of multiple sclerosis phenotypes with single nucleotide polymorphisms of IL7R, LAG3, and CD40 genes in a Jordanian population: A
genotype-phenotype study. _Biomolecules_ 10, 356 (2020). Article CAS Google Scholar * Rajasuriar, R. _et al._ The role of SNPs in the α-chain of the IL-7R gene in CD4+ T-cell recovery in
HIV-infected African patients receiving suppressive cART. _Genes Immun._ 13, 83–93 (2012). Article CAS Google Scholar * Guzmán-Fulgencio, M. _et al._ Association between IL7RA
polymorphisms and the successful therapy against HCV in HIV/HCV-coinfected patients. _Eur. J. Clin. Microbiol. Infect. Dis._ 34, 385–393 (2015). Article Google Scholar * Jiménez-Sousa, M.
A. _et al._ The IL7RA rs6897932 polymorphism is associated with progression of liver fibrosis in patients with chronic hepatitis C: Repeated measurements design. _PLoS ONE_ 13, e0197115
(2018). Article Google Scholar * Andreu-Ballester, J. C. _et al._ Deficit of interleukin 7 in septic patients. _Int. Immunopharmacol._ 23, 73–76 (2014). Article CAS Google Scholar *
Zhang, X., Ding, L. & Sandford, A. Selection of reference genes for gene expression studies in human neutrophils by real-time PCR. _BMC Mol. Biol._ 6, 4 (2005). Article Google Scholar
* Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) methods. _Methods_ 25, 402–408 (2001). Article
CAS Google Scholar * Dubridge, F. Pedigree disequilibrium tests for multilocus haplotypes. _Genet. Epidemiol._ 25, 115–121 (2003). Article Google Scholar * Ampuero, S., Luchsinger, V.,
Tapia, L., Palomino, M. A. & Larrañaga, C. E. SP-A1, SP-A2 and SP-D gene polymorphisms in severe acute respiratory syncytial infection in Chilean infants. _Infect. Genet. Evol._ 11,
1368–1377 (2011). Article CAS Google Scholar * Demaret, J. _et al._ STAT5 phosphorylation in T cell subsets from septic patients in response to recombinant human interleukin-7: A pilot
study. _J. Leukoc. Biol._ 97, 791–796 (2015). Article CAS Google Scholar * Todd, J. _et al._ Robust associations of four new chromosome regions from genome-wide analyses of type 1
diabetes. _Nat. Genet._ 39, 857–864 (2007). Article CAS Google Scholar * Hoe, E. _et al._ Functionally significant differences in expression of disease-associated IL-7 receptor a
haplotypes in CD4 T cells and in dendritic cells. _J. Immunol._ 184, 2512–2517 (2010). Article CAS Google Scholar * Lundtoft, C., Seyfarth, J. & Jacobsen, M. IL7RA genetic variants
differentially affect IL-7Rα expression and alternative splicing: a role in autoimmune and infectious diseases?. _Genes Immun._ 21, 83–90 (2020). Article CAS Google Scholar * Al-Mossawi,
H. _et al._ Context-specific regulation of surface and soluble IL7R expression by an autoimmune risk allele. _Nat. Commun._ 10, 4575 (2019). Article ADS Google Scholar * Passtoors, W. _et
al._ IL7R gene expression network associates with human healthy ageing. _Immun. Ageing._ 12, 21 (2015). Article Google Scholar * Kreft, K. L. _et al._ Decreased systemic IL-7 and soluble
IL-7Rα in multiple sclerosis patients. _Genes Immun._ 13, 587–592 (2012). Article CAS Google Scholar * Francois, B. _et al._ Interleukin-7 restores lymphocytes in septic shock: the IRIS-7
randomized clinical trial. _JCI Insight._ 3, e98960 (2018). Article Google Scholar Download references ACKNOWLEDGEMENTS This work was supported by the Grant (No. 1171643) from Fondo
Nacional de Desarrollo Científico y Tecnológico (FONDECYT), Chile, and by Líneas de apoyo a la investigación from ICBM (2022). The authors thank Mr. Cristian Moreno and Miss Dina Silva for
excellent laboratory assistance and Miss Patricia Cabrera and nurse and kinesiology team of Dr. Lucio Córdova and San José hospitals for their excellent collaboration. AUTHOR INFORMATION
AUTHORS AND AFFILIATIONS * Programa de Virología, ICBM, Facultad de Medicina, Universidad de Chile, Av. Independencia 1027, Independencia, Santiago, Chile Sandra Ampuero, Guillermo
Bahamonde, Luis Lizama, Luis F. Avendaño & Vivian Luchsinger * Programa de Inmunología, ICBM, Facultad de Medicina, Universidad de Chile, Santiago, Chile Fabián Tempio & Mercedes
López * Instituto Milenio de Inmunología e Inmunoterapia, Facultad de Medicina, Universidad de Chile, Santiago, Chile Fabián Tempio & Mercedes López * Instituto de Nutrición y Tecnología
de los Alimentos, Universidad de Chile, Santiago, Chile María Luisa Garmendia * Departamento de Medicina, Hospital Clínico Universidad de Chile, Santiago, Chile Mauricio Ruiz * Hospital
Lucio Córdova, Santiago, Chile Rolando Pizarro * Complejo Hospitalario San José, Santiago, Chile Patricio Rossi & Lucía Huenchur Authors * Sandra Ampuero View author publications You can
also search for this author inPubMed Google Scholar * Guillermo Bahamonde View author publications You can also search for this author inPubMed Google Scholar * Fabián Tempio View author
publications You can also search for this author inPubMed Google Scholar * María Luisa Garmendia View author publications You can also search for this author inPubMed Google Scholar *
Mauricio Ruiz View author publications You can also search for this author inPubMed Google Scholar * Rolando Pizarro View author publications You can also search for this author inPubMed
Google Scholar * Patricio Rossi View author publications You can also search for this author inPubMed Google Scholar * Lucía Huenchur View author publications You can also search for this
author inPubMed Google Scholar * Luis Lizama View author publications You can also search for this author inPubMed Google Scholar * Mercedes López View author publications You can also
search for this author inPubMed Google Scholar * Luis F. Avendaño View author publications You can also search for this author inPubMed Google Scholar * Vivian Luchsinger View author
publications You can also search for this author inPubMed Google Scholar CONTRIBUTIONS V.L., S.A. and L.F.A. designed the study; M.R., R.P., P.R. and L.H. enrolled patients and collected
clinical data; G.M., F.T. and L.L. performed quantifications and detections in laboratory; G.B., S.A., F.T., M.L. and V.L. analyzed the data; M.L.G. performed statistical analyses; S.A.,
G.B. and V.L. are the major contributors in writing the manuscript; L.F.A., F.T., M.L.G., M.R., R.P., M.L.G. and M.L. reviewed the manuscript. All authors read and approved the final
manuscript. CORRESPONDING AUTHOR Correspondence to Vivian Luchsinger. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing interests. ADDITIONAL INFORMATION
PUBLISHER'S NOTE Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. SUPPLEMENTARY INFORMATION SUPPLEMENTARY TABLES.
RIGHTS AND PERMISSIONS OPEN ACCESS This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and
reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes
were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material.
If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to
obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS
ARTICLE Ampuero, S., Bahamonde, G., Tempio, F. _et al._ IL-7/IL7R axis dysfunction in adults with severe community-acquired pneumonia (CAP): a cross-sectional study. _Sci Rep_ 12, 13145
(2022). https://doi.org/10.1038/s41598-022-13063-x Download citation * Received: 18 November 2021 * Accepted: 08 April 2022 * Published: 30 July 2022 * DOI:
https://doi.org/10.1038/s41598-022-13063-x SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable link is not
currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative