Comparison of uridine diphosphate-glycosyltransferase ugt76g1 genes from some varieties of stevia rebaudiana bertoni

ABSTRACT Stevia leaves contain various components, such as flavonoids, labdanes, chlorophylls, sterols, triterpenoids, mono-disaccharides, organic acids and inorganic salts. Stevia is known

to accumulate diterpenoid steviol glycosides, which are approximately 300 times sweeter than regular sugar. Stevioside and rebaudioside A are the main diterpenic glycosides in stevia.

Steviol glycosides are the secondary metabolites responsible for the sweetness of stevia. The main objectives of the present study were to determine the concentrations of diterpenic

glycosides (stevioside and rebaudioside A) in three stevia varieties (_Stevia rebaudiana) via_ the HPLC-UV technique and to amplify the UGT76G1 gene by PCR using gene-specific primers. The

expression levels of the UGT76G1 gene were determined in the three stevia varieties. The PCR products were sequenced and analyzed, and the nucleotide sequences of the UGT76G1 gene were

submitted to GenBank and assigned to the following three varieties: Egy1 (MH087463), China1 (MH087464) and Sponti (MH087465). Cluster analysis was used to separate the three varieties into

two major clusters based on their phylogenetic relationship. In addition, chemical analysis was carried out to evaluate stevioside and rebaudioside A. The present study concluded that Egy1

and Sponti are closely related varieties as they fall in the same cluster, while China1 forms a separate cluster. Bioprospecting studies could be useful for selection of superior ecotypes of

_Stevia rebaudiana_. SIMILAR CONTENT BEING VIEWED BY OTHERS MOLECULAR CLONING AND EXPRESSION ANALYSIS OF SUCROSE PHOSPHATE SYNTHASE GENES IN CASSAVA (_MANIHOT ESCULENTA_ CRANTZ) Article

Open access 26 November 2020 IDENTIFICATION AND ANALYSIS OF ISOFLAVONE REDUCTASE GENE FAMILY IN _GOSSYPIUM HIRSUTUM_ L. Article Open access 07 April 2023 EXPLORING THE VERSATILITY OF

SESQUITERPENE BIOSYNTHESIS IN GUAVA PLANTS: A COMPARATIVE GENOME-WIDE ANALYSIS OF TWO CULTIVARS Article Open access 05 January 2024 INTRODUCTION Stevia plants are an important source of

commercial steviol glycosides (SGs)1. SGs are used as alternative natural sweeteners and have applications in the control of diseases caused by modern lifestyles, such as obesity, diabetes,

hypertension and cardiac blockage2,3,4. Up to thirty percent of diterpenoid steviol glycosides accumulate in dry stevia leaves5. Steviol glycosides are sweeter than sugar and noncalorific

sweeteners that are used worldwide. Eight different steviol glycosides are produced in stevia plants. Stevioside constitutes a majority of sweeteners (60~70%) with high potential medicinal

value6,7,8. Rebaudioside A is of particular interest, due to the desirable flavor profile of this compound and is considered to be antidiabetic, noncariogenic and mutagenic9. Diterpene

glycosides are currently used in different varieties of food products (pickled vegetables, dried sea food, beverages, candies, chewing gum, yogurt, _etc_.). Different techniques are used to

determine the glycoside content in plants (_e.g_., gas chromatography, HPLC, LC-MS, infrared spectroscopy). HPLC is a reliable method that has been used to determine the composition of

_Stevia rebaudiana_10,11,12,13. Plant UDP-glycosyltransferases (UGTs) are a unique group of enzymes that transfer sugar residue from an activated donor to an acceptor

molecule14,15,16,17,18,19. UDP-glycosyltransferases were mostly unidentified until recently, and detailed functional characterization of these enzymes is only just beginning. Complete genome

sequencing uncovered 112 full-length candidate UGTs in _Arabidopsis_, and these results led to the characterization of many new activities20,21,22,23,24. In _Stevia_,

UDP-glycosyltransferases are involved in the production of steviol glycosides, compounds that are unique in the plant world due to their intense sweetness and high concentration in

leaves25,26. In stevia, kaurene is transformed to steviol, the backbone of the sweet glycosides; steviol is also transformed to many glycosides by uridine-diphosphate-dependent

glycosyltransferases (UGTs)27,28,29. The C-19 carboxylate and C-13 alcohol oxygenated functional groups of steviol provide attachment points for the sugar side chains that determine the

identity of the glycosides. The addition of the C-13-glucose to steviol is catalyzed by UGT85C2, first yielding steviolmonoside and then steviolbioside; the addition of the C-19-glucose is

catalyzed by UGT74G1, yielding stevioside30,31; and finally, glucosylation of the C-3′ of the glucose at the C-13 position is catalyzed by UGT76G1, yielding rebaudioside A27,32. The UGT76G1

gene is responsible for the conversion of stevioside to rebaudioside A and improves the organoleptic properties of steviol glycosides33; therefore, the present study was focused on UGT76G1.

To differentiate between three stevia varieties, biochemical analysis of the three varieties was carried out, to determine the concentrations of both stevioside and rebaudioside A in stevia

leaves using HPLC. Moreover, the gene expression levels of UGT76G1 in the three stevia varieties. Furthermore, the UGT76G1 gene was characterized _via_ gene sequencing to determine the

genetic similarity of the three stevia varieties, and the obtained sequences were submitted to GenBank to identify accession numbers. MATERIAL AND METHODS SAMPLE COLLECTION Mature leaves (3

months old) of three stevia varieties (Egy1, China1 and Sponti of _S. rebaudiana_) were collected from the middle parts of plants (between internodes 10 and 15) from the Sugar Crops Research

Institute, Agricultural Research Center (SCRI-ARC), Ministry of Agriculture, Egypt. Cooperating with Botany and Microbiology Department, College of Science, King Saud University, Saudi

Arabia. SWEET DITERPENE GLYCOSIDE EXTRACTION The collected leaves were oven-dried (E. Schulz & Co. Inh. Franz. Skorezewsh KOMEG Technology, China) at 50 °C and then ground to a fine

powder according to34 with some modifications as follows: 5 g of dried leaf powder was extracted with 50 ml of hot methanol using a Soxhlet apparatus for 2 hrs. The extract was filtered

using Whatman no. 1 filter paper, and the residue was re-extracted twice with methanol at room temperature. The filtrate was further concentrated in rotary flash evaporator (Type 349, James

Jobling and Co. Ltd., England) at 60 °C to 10 ml, and then, 50 ml of distilled water was added to the concentrated extract. A phase separation step was performed to remove plant pigments as

follows: 25 ml of diethyl ether was added to the extract in a 500-ml separatory funnel (Sigma Aldrich), and the aqueous phase was collected and extracted with butanol. Finally, the butanol

upper layer was collected and refrigerated overnight at 4 °C to allow the purified glycosides to form crystals. Then, the crystals were separated by filtration and analyzed using HPLC34.

Each stevia sample was extracted twice. PREPARATION OF THE STEVIOSIDE STANDARD Stevioside standard preparation was carried out according to the method described by Nishiyama _et al_.35 with

minor modifications as follows: dried leaves of _S. rebaudiana_ Bertoni (10 g) collected from Sugar Crops Research Institute (SCRI), Agricultural Research Center (ARC), Ministry of

Agriculture, Egypt, were extracted by soaking leaves in 1.0 liter of hot distilled water (85 °C) for 30 minutes. The resulting liquid fractions were filtered using a Buchner filtration

system, and the leaves were then washed with an additional volume of hot water (50 ml). The aqueous solution was concentrated to 50 ml in a freeze-drier (Edwards model EF03, England). The

extract was defatted by ethyl acetate followed by extraction with isobutyl alcohol (150 ml). The aqueous phase was discarded, and the organic phase was evaporated until dryness by using a

rotary evaporator (Type 349, James Jobling and Co. Ltd., England) at 70 °C. The dry pellets were dissolved in hot methanol (100 ml) and allowed to crystallize overnight. The crystals were

separated by filtration and dissolved in boiling methanol (50 ml) to obtain a concentrated solution. The solution was clarified with active charcoal (B.D.H. Laboratory Chemicals Division,

Poole, England) and left to recrystallize. The procedure was repeated three times until the formation of colorless crystals. The pure solution of the stevioside standard was subjected to

HPLC analysis. ANALYSIS OF SGS BY HPLC High-performance liquid chromatography (HPLC) technology can be used to directly measure the levels of steviol glycosides (rebaudioside A and

stevioside) in _Stevia rebaudiana_ Bertoni36. The levels of stevia sweetener compounds were estimated at the Central Laboratory, Faculty of Science, Alexandria University. Leaf extracts were

separated and identified by HPLC according to37 as follows: the stevioside solution was filtered through a Millipore membrane (13 mm diameter, 0.5 μm pore size) and analyzed using HPLC with

a stevioside standard as an internal standard (10 mg/ml). Different extracts of stevia leaves were injected into an HPLC instrument (Shimadzu, Tokyo, Japan; model SPD-6AV) equipped with an

LC-GA UV-vis detector and an Alex C-R 4 A recorder. The separation was carried out on a Zorbax NH2 column (25 cm × 0.4 mm I.D.; Dupont, Wilmington, DE, USA) with acetonitrile (HPLC grade,

Fisons Co., England) as the mobile phase (acetonitrile: water (80: 20 v/v), adjusted to pH 5 with H3PO4). The flow rate was 2 ml/min; the UV detection wavelength was 210 nm; the recorder

chart speed was 20 nm/min; and the analysis was performed at ambient temperature (25 °C). Two samples per variety were analyzed, and the quantities of stevioside and rebaudioside A were

calculated from the area under each peak. PCR AMPLIFICATION OF THE STEVIA UGT76G1 GENE Fresh leaf samples of three stevia varieties (three months old), namely, China1, Egy1 and Sponti, were

used to extract total genomic DNA using the DNA Mini-Prep Kit (BIO BASIC, Canada). The stevia UGT76G1 gene was amplified by using gene-specific primers UGT76G1 FP (5′ AACGTCAGTCAAACCCAATG3′)

and UGT76G1 RP (5′ CTCACATAACCAACAACCATCC3′) according to33. The PCR was performed in a 25-µl reaction mixture containing 1 µl of 100 ng/µl DNA, 1 µl of each primer at a concentration of

0.01 nmol/µl, 12.5 µl of master mix (2.5 µl of 10 × PCR buffer, 1.5 µl of 25 mM MgCl2, 2.0 µl of 2.5 mM dNTP, and 0.125 µl of Taq DNA polymerase) (BIOLINE, UK) and 9.5 µl of water (H2O). The

PCR program was as follows: denaturation for 5 min at 95 °C; 35 cycles of 40 s at 94 °C, 40 s at 55 °C and 2 min at 72 °C; and 72 °C for 10 min. Then, 2% agarose gel electrophoresis with

ethidium bromide was used to separate the PCR product. The image was recorded using a gel documentation system (Alpha Image, USA). Clearly separated DNA bands of PCR products (approximately

1500 bp) were cut from the gel and purified using the GF-1 AmbiClean Kit (PCR & Gel, Vivantis, WE CARE, Malaysia). Then, the purified PCR products were submitted for sequencing at

Macrogene (Korea). The sequences were analyzed and compared by NCBI BLAST (http://blast.ncbi.nlm.nih.gov); the sequences were aligned to generate a phylogenetic tree by using Molecular

Evolutionary Genetics Analysis (MEGA5) software. The sequences were submitted to GenBank (gb-admin@nbci.nlm.nih.gov), and each sequence was assigned a GenBank accession number. GENE

EXPRESSION ANALYSIS OF UGT76G1 (QRT-PCR) RNA EXTRACTION AND CDNA SYNTHESIS Total RNA was isolated from stevia leaves using the BS82314-50 Preps EZ-10 Spin Column Plant RNA Mini-Prep Kit (BIO

BASIC, Canada). For cDNA synthesis, the first strand of cDNA was synthesized using M-MuLV reverse transcriptase (New England Bio Labs Inc.). The samples were incubated at 42 °C for 1 hr and

then 72 °C for 10 minutes. cDNA samples were stored at −20 °C. Every 20 µl of the reverse transcription mixture contained 1 µl of template RNA, 2 µl of oligo (dT) primer, 2 µl of 10 × 

M-MuLV buffer, 1 µl of M-MuLV RT (200 U/µl), 1 µl of 10 mM dNTP mix, and nuclease-free water to a total volume of 20 µl. QUANTITATIVE REAL-TIME PCR ANALYSIS (QRT-PCR) Primer design for the

UGT76G1 gene is recorded in Table (1). The stevia actin gene was used as an internal control for data normalization. For relative quantification of gene expression, qRT-PCR was conducted in

an Eppendorf Master Cycler ep realplex using the following PCR cycling conditions: 2 min at 95 °C, followed by 40 cycles of 5 s at 95 °C, 10 s at 60 °C and 5 s at 72 °C; then, melting curve

analysis was performed according to33. Expression of the UGT76G1 gene was determined by quantitative qRT-PCR on a Thermo Scientific PikoReal 96 real-time PCR system

(www.thermoscientific.com/pikoreal) with the SYBR Green SensiFASTTM SYBR® No-ROX Kit (BIOLINE). Relative quantification by real-time PCR was performed in a 10 µl volume containing 1 μl of

cDNA, 5 µl of 2 × SensiFAST SYPBR® No-ROX mix, 0.5 µl of each primer, and 3 µl of H2O. For quantitative real-time PCR data analysis, relative expression of UGT76G1 was calculated based on

the threshold cycle using the 2−ΔΔCq method38. The expression levels of target genes were normalized using the stevia actin gene as an internal control, and the relative transcript levels

were calculated as follows according to39. $$\begin{array}{c}{\boldsymbol{\Delta

}}\text{Cq}\,(\text{Control},\,\text{Treatment})={\bf{Cq}}({\rm{Target}}\,{\rm{gene}})-{\bf{Cq}}({\rm{Reference}}\,{\rm{gene}}),\\ \,{\rm{where}}\,{\boldsymbol{\Delta }}{\boldsymbol{\Delta

}}\text{Cq}\,{\rm{expression}}={2}^{-{\rm{nCq}}39}\end{array}$$ STATISTICAL ANALYSIS Data analysis was performed by using the Excel software program; gene expression was examined for three

biological replicates of each variety. A t-test at p < 0.05 was applied to determine significant differences in gene expression between the three varieties, and standard deviations were

calculated for the means of the biological replicates. COMPLIANCE WITH ETHICS REQUIREMENTS This article does not contain any studies with human or animal subjects. RESULTS CHEMICAL ANALYSIS

OF STEVIA SWEETENERS HPLC was used to determine the levels of stevioside and rebaudioside A. The results shown in Table (2) and Fig. (1A–C) indicate that the highest stevioside content was

observed in the Sponti variety (21.46%), followed by China1 (0.18%) and finally Egy1 (12.27%). The range from lowest to highest value was 12.27 to 21.46% (with a 9.19% increase observed for

the Sponti variety, Table 2). The highest levels of rebaudioside A were observed in China1 and Egy1 (15.54% and 14.48%, respectively), while a value of 13.02% was observed for the Sponti

variety (Table 2). PCR AMPLIFICATION OF UGT76G1 The UGT76G1 gene was amplified from the stevia varieties by PCR using the designed primers (UGT76G1 F and R). The PCR assay showed an

amplification product of the expected size (1.51 kb), as shown in Fig. (2). These data are consistent with33, in which a product with same molecular weight was detected. UGT76G1 GENE

SEQUENCING AND PHYLOGENETIC ANALYSIS The polymerase chain reaction amplification products of the UGT76G1 gene were sequenced and analyzed to determine nucleotide similarity among the three

stevia varieties, as shown in Fig. (3). Data were submitted to GenBank for identification of the accession numbers for each sequence (Table 3, Figs 4 and 5). The partial sequence of the

UGT76G1 gene was aligned and compared to the sequences in GenBank. A dendrogram was generated using MEGA5 software to examine the phylogenetic relationship of UGT76G1 among the three stevia

varieties, namely, Egy1, China1 and Sponti. The observed similarity might be the result of the existence of a common ancestor for Egy1 and Sponti, and this ancestor might differ from the

ancestor of China1 (Fig. 6). The generated genetic similarity dendrogram for the three stevia varieties classified the populations into two major groups: Group I (Egy1 and Sponti) and Group

II (China1). The results showed that Egy1 and Sponti belong to the same cluster (Figs 6 and 7). GENE EXPRESSION ANALYSIS OF UGT76G1 The data presented in Table (4) and Fig. (8) indicate that

the gene expression of UGT76G1 varied significantly between the three stevia varieties under investigation. Based on the obtained results, China1 showed the highest gene expression level,

exhibiting a ΔΔCq value of 0.178, followed by Egy1, which exhibited a relatively low expression level (ΔΔCq value of 0.119). The lowest gene expression level was reported for the Sponti

variety, which showed a ΔΔCq value of 0.074, and these values were significantly different for the three varieties (p = 0.05). The relative gene expression of UGT76G1 was significantly high

between China1 and Egy1 (value of 0.002), followed by China1 and Sponti and Egy1 and Sponti (0.0001 and 0.0007, respectively). These results support the finding obtained using HPLC analysis

that showed a significant increase in rebaudioside A concentrations in China1 compared to Sponti. DISCUSSION The stevioside content observed in this study was higher than that reported by

Parris _et al_.39, in which the concentration ranged from 2.8–5.49%25 and 6.98–12.16%. For rebaudioside A content, China1 exhibited the highest value (15.54%), while Sponti exhibited the

lowest value (13.02%). A low value for rebaudioside content was also reported by40. The variation in stevioside content and rebaudioside A content was further speculated to be associated

with increasing altitude, resulting in decreasing temperature and in turn in accumulation of stevioside. Recently, stevia has received much attention. Rebaudioside A represents 30–40% of

total glycosides41, but in the current study, the rebaudioside A levels of the stevia varieties China1, Egy1 and Sponti were 15.54%, 14.48% and 13.02% of the total glycosides, respectively.

Therefore, these varieties are considered good materials for the study of the synthesis of steviol glycosides. The results of the present study are consistent with those of previous studies

that determined stevioside, rebaudioside A and steviol levels via different methods42. HPLC and NIR spectroscopy models have been used to directly measure the steviol glycoside content in

_S. rebaudiana_ Bertoni to decrease the cost and complexity of operation36. The UGT76G1 gene was amplified from the stevia varieties by PCR using the designed primers (UGT76G1 F and R). The

PCR assay showed an amplification product of the expected size (1.51 kb), which is in accordance with Li _et al_.24. The phylogenetic analysis indicated that the three sequences were grouped

with UGT76G1 in the same cluster, indicating a close relatedness between UGTSr and UGT76G1. The phylogenetic analysis showed a close relationship between UGTSr and UGT76G143. The UGT76G1

obtained from the Egy1 variety (accession number MH087463) was closely related to _S. rebaudiana_ KC631816.1 and AY345974.1 (UGT76G1 genes), with a nucleotide sequence similarity of 88%.

Additionally, the nucleotide sequence from China1 (accession number MH087464) showed high nucleotide sequence similarity (98%) with _Stevia rebaudiana_ KC631816.1, AY345974.1 and FJ607329.1

(UGT76G2 genes). In contrast, the nucleotide sequence obtained from Sponti (accession number MH087465) was closely related to KC631816.1 and AY345974.1 with a similarity of 87%. Moreover,

China1 showed high similarity with XM_022150661.1 (_Helianthus annuus_ UGT76G1), while Egy1, China1 and Sponti showed low similarity with FJ607329.1 (_Stevia rebaudiana_ UGT76G2),

XM_022150639.1 (_Helianthus annuus_ UGT76G1), XM_022150662.1 (_Helianthus annuus_ UGT76G1), and GQ259127.1 (_Stevia rebaudiana_ UGT76G1). In a previous study, a mutation in the UGT76G1 gene

was found to cause a reduction in rebaudioside A accumulation to 0.2% compared to normal plants, which usually exhibited 30–40% accumulation of total glycosides33. It was concluded that

these three UGTs were not expressed at higher levels than any of the other UGTs. The expression of these genes was in the following order: UGT85C2 > UGT76G1 > UGT74G1. In the present

study, we used qRT-PCR, a highly sensitive and specific method, to accurately measure the transcript levels of the three varieties44. Increased transcript levels of the UGT76G1 enzymes

increased the level of the final product of the biosynthetic pathway, rebaudioside A45,46. Rebaudioside A accumulation is one of the most important traits contributing to the economic value

of stevia crops47. CONCLUSION The present study investigated the relationship among three _Stevia_ varieties using HPLC and molecular techniques. Sequence analysis was used to determine the

nucleotide similarity of the stevia varieties China1, Egy1, and Sponti. The three varieties were clustered into two major groups and showed close similarity to UGT76G1. Phylogenetic

relationships among different sequences of _S. rebaudiana_ UGT76G1 were studied. A dendrogram of genetic similarities among the three varieties was constructed. The results indicated that

the three varieties were clustered into two major groups: Group I (Egy1 and Sponti) and Group II (China1). This similarity might be the result of the existence of a common ancestor for Egy1

and Sponti, and this ancestor might be different from the ancestor of China1. The results obtained for the gene expression of UGT76G1 indicated that China1 showed the highest gene expression

levels compared to the other two varieties, and the gene expression level of UGT76G1 was significantly higher in China1 than in the two varieties. REFERENCES * Gopal, S. _et al_. Molecular

dissection of transcriptional reprogramming of steviol glycosides synthesis in leaf tissue during developmental phase transitions in _Stevia rebaudiana_ Bert. _Scientific Reports_ 7(1),

11835, https://doi.org/10.1038/s41598-017-12025-y (2017). Article  CAS  ADS  Google Scholar  * Hsieh, M. H. _et al_. Efficacy and tolerability of oral stevioside in patients with mild

essential hypertension: a two-year, randomized, placebo-controlled study. _Clinical Therapeutics_ 25(11), 2797–2808, https://doi.org/10.1016/S0149-2918(03)80334-X (2003). Article  CAS 

PubMed  Google Scholar  * Gregersen, S., Jeppesen, P. B., Holst, J. J. & Hermansen, K. Stevia: Steps to developing a new sweetener. _Metabolism: Clinical and Experimental_ 53(1), 73–76,

https://doi.org/10.1016/j.metabol.2003.07.013 (2004). Article  CAS  Google Scholar  * Samant, S. S., Wilkes, K., Odek, Z. & Seo, H. S. Tea-induced calmness: Sugar-sweetened tea calms

consumers exposed to acute stressor. _Scientific reports_ 16(6), 36537, https://doi.org/10.1038/srep36537 (2016). Article  CAS  ADS  Google Scholar  * Geuns, J. M. C. Molecules of Interest

Stevioside. _Phytochemistry_ 64, 913–921, https://doi.org/10.1016/S0031-9422(03)00426-6 (2003). Article  CAS  PubMed  Google Scholar  * Jeppesen, P. B. _et al_. Antihyperglycemic and blood

pressure-reducing effects of stevioside in the diabetic Goto-Kakizaki rat. _Metabolism_ 52(3), 372–378, https://doi.org/10.1053/meta.2003.50058 (2003). Article  CAS  PubMed  Google Scholar 

* Chen, J. _et al_. Stevioside does not cause increased basal insulin secretion orb-cell desensitization as does the sulphonylurea, glibenclamide: studies _in vitro_. _Life Sci._ 78,

1748–1753, https://doi.org/10.1016/j.lfs.2005.08.012 (2006). Article  CAS  PubMed  Google Scholar  * Ferri, L. A. _et al_. Investigation of the antihypertensive effect of oral crude

stevioside in patients with mild essential hypertension. _Phytother Res._ 20, 732–736, https://doi.org/10.1002/ptr.1944 (2006). Article  CAS  PubMed  Google Scholar  * Yadav, S. K. &

Guleria, P. Steviol glycosides from stevia: Biosynthesis pathway review and their application in foods and medicine. _Crit. Rev. Food Sci. Nutr._ 52, 988–998,

https://doi.org/10.1080/10408398.2010.519447 (2012). Article  CAS  PubMed  Google Scholar  * Kovylyaeva, G., _et al_. Glycosides from _Stevia rebaudiana_. _Chem. Nat. Compounds_ 43, 81–85,

0009-3130/07/4301-0081 (2007). * Samah, N. A., Hisham, A. D. A., & Rahim, S. A. Determination of stevioside and rebaudioside A in Stevia rebaudiana leaves via preparative high

performance liquid chromatography (prep-HPLC). _International Journal_, 4(2), https://doi.org/10.4236/ajac.2015.611083 (2013). Article  Google Scholar  * Cacciola, F. _et al_. Employing

ultra high pressure liquid chromatography as the second dimension in a comprehensive two-dimensional system for analysis of Stevia rebaudiana extracts, _J. Chromatogr. A_, 1218(15),

2012–2018, 0009-3130/07/4301-0081 https://doi.org/10.1016/j.chroma.2010.08.081 (2011). Article  CAS  Google Scholar  * Martono, Y., Trihandaru, S. & Rondonuwu, F. S. Determination of

Stevioside and Rebaudioside A in Stevia rebaudiana Bertoni Leaves Using near Infrared Spectroscopy and Multivariate Data Analysis. _Indonesian Journal of Chemistry_ 18(4), 664–671,

https://doi.org/10.22146/ijc.25580 (2018). Article  CAS  Google Scholar  * Hughes, J. & Hughes, M. A. Multiple secondary plant product UDP-glucose glucosyltransferases genes expressed in

cassava (Manihot esculenta Crantz) cotyledons. _DNA Seq._ 5, 41–49, https://doi.org/10.3109/10425179409039703 (1994). Article  CAS  PubMed  Google Scholar  * Paquette, S., Moller, B. L.

& Bak, S. On the origin of family 1 plant glycosyltransferases. _Phytochemistry_, 62, 399–413, 0031-9422/03/$ (2003). * Behroozi, P., Baghizadeh, A., Saei, A. & Kharazmi, S.

Quantitative analysis of uridine diphosphate glycosyltransferase UGT85C2, UGT74G1 and UGT76G1 genes expression in Stevia rebaudiana under different irrigations. _Russian journal of plant

physiology_ 64(1), 67–72, https://doi.org/10.1134/S1021443717010034 (2017). Article  CAS  Google Scholar  * Nguyen, T. T. H. _et al_. Enzymatic Production of Steviol Glucosides Using

β-Glucosidase and Their Applications. In Enzymes in Food Biotechnology (pp. 405–418). _Academic Press_, https://doi.org/10.1016/B978-0-12-813280-7.00023-2 (2019). Chapter  Google Scholar  *

Ghaheri, M., Kahrizi, D., Bahrami, G. & Mohammadi-Motlagh, H. R. Study of gene expression and steviol glycosides accumulation in Stevia rebaudiana Bertoni under various mannitol

concentrations. _Molecular biology reports_, 1–10, https://doi.org/10.1007/s11033-018-4250-4 (2018). Article  Google Scholar  * Petit, E., Jacques, A., Daydé, J., Vallejo, V. & Berger,

M. UGT76G1 polymorphism in Stevia rebaudiana: New variants for steviol glycosides conjugation. _Plant Physiology and Biochemistry_ 135, 563–569, https://doi.org/10.1016/j.plaphy.2018.11.002

(2019). Article  CAS  PubMed  Google Scholar  * Jones, P., Messner, B., Nakajima, J.-I., Scha¨ ffner, A. R. & Saito, K. UGT73C6 and UGT78D1, glycosyltransferases involved in flavanol

glycoside biosynthesis in Arabidopsis thaliana. _J. Biol. Chem._ 45, 43910–43918, https://doi.org/10.1074/jbc.M303523200 (2003). Article  Google Scholar  * Lim, E.-K., Higgins, G. S., Li, Y.

& Bowles, D. J. Regioselectivity of glucosylation of caffeic acid by a UDP-glucose:glucosyltransferase is maintained in planta. _Biochem. J._ 373, 987–992 (2003). Article  CAS  Google

Scholar  * Messner, B., Thulke, O. & Scha¨ ffner, A. R. Arabidopsis glucosyltransferases with activities toward both endogenous and xenobiotic substrates. _Planta_ 217, 138–146,

https://doi.org/10.1007/s00425-002-0969-0 (2003). Article  CAS  PubMed  Google Scholar  * Jackson, R. G. _et al_. Identification and biochemical characterization of an Arabidopsis indole-

3-acetic acid glucosyltransferase. _J. Biol. Chem._ 276, 4350–4356, https://doi.org/10.1074/jbc.M006185200 (2001). Article  CAS  PubMed  Google Scholar  * Li, Y., Baldauf, S., Lim, E.-K.

& Bowles, D. J. Phylogenetic analysis of the UDP-glycosyltransferase multigene family of Arabidopsis thaliana. _J. Biol. Chem._ 276, 4338–4343, https://doi.org/10.1074/jbc.M007447200

(2001). Article  CAS  PubMed  Google Scholar  * Brandle, J. E. & Rosa, N. Heritability for yield, leaf: stem ratio and stevioside content estimated from a landrace cultivar of _Stevia

rebaudiana_. _Can. J. Plant Sci._ 72, 1263–1266, https://doi.org/10.4141/cjps10086 (1992). Article  CAS  Google Scholar  * Starratt, A. N., Kirby, C. W., Pocs, R. & Brandle, J. E.

Rebaudioside F, a diterpene glycoside from Stevia rebaudiana. _Phytochemistry_ 59, 367–370, https://doi.org/10.1016/S0031-9422(01)00416-2 (2002). Article  CAS  PubMed  Google Scholar  *

Richman, A. S., Gijzen, M., Starratt, A. N., Yang, Z. & Brandle, J. E. Diterpene synthesis in _Stevia rebaudiana_: Recruitment and up-regulation of key enzymes from the gibberellin

biosynthetic pathway. _Plant J._ 19, 411–421, https://doi.org/10.1046/j.1365-313X.1999.00531.x (1999). Article  CAS  PubMed  Google Scholar  * Richman, A. _et al_. The major sweet glucosides

of _Stevia rebaudiana_. _Plant J._ 41, 56–67, https://doi.org/10.1111/j.1365-313X.2004.02275.x (2005). Article  CAS  PubMed  Google Scholar  * Humphrey, T. V., Richman, A. S., Menassa, R.

& Brandle, J. E. Spatial organization of four enzymes from Stevia rebaudiana that are involved in steviol glycoside synthesis. Plant Molecular. _Biol._ 61, 47–62,

https://doi.org/10.1007/s11103-005-5966-9 (2006). Article  CAS  Google Scholar  * Shibata, H., Sonoke, S., Ochiai, H., Nishihashi, H. & Yamada, M. Glucosylation of steviol and

steviol-glucosides in extracts from _Stevia rebaudiana_ Bertoni. _Plant Physiol_, 95, 152–15 6, 0032-0889/91/95/01 52/05 (1991). * Shibata, H., _et al_. Steviol and Steviol-Glycoside:

glucosyltransferase activities in _Stevia rebaudiana_ Bertoni-purification and partial characterization. _Arch. Biochem. Biophys_., 321, 390–396, 0003-9861/95 (1995). Article  CAS  Google

Scholar  * Brandle, J. E. & Telmer, P. G. Steviol glycoside biosynthesis. _Phytochemistry_ 68, 1855–1863, https://doi.org/10.1016/j.phytochem.2007.02.010 (2007). Article  CAS  PubMed 

Google Scholar  * Yang, Y. H. _et al_. Base substitution mutations in uridinediphosphate-dependent glycosyltransferae 76G1 gene of _Stevia rebaudiana_ causes the low levels of rebaudioside A

Mutations inUGT76G1, A key gene of steviol glycosides synthesis, Plant Physiology and Biochemistry 80, 220–225, https://doi.org/10.1016/j.plaphy.2014, 04.005 (2014). * Harmanjit, K.

Chromatographic determination of stevioside in leaf parts of _in vitro_ and _in vivo_ regenerated plants of _Stevia rebaudiana_. _International Journal of Natural Products Research._ 1(4),

2249–2253 (2011). Google Scholar  * Nishiyama, P., Alvarey, M. & Vieira, L. Quantitative analysis of stevioside in the leaves of _Stevia rebaudiana_ by Near Infrared reflectance

spectroscopy. _3. Sci. Food Agric_. 59, 277–281, 0022-5142/92/$05.00 (1992). * Yu, C., Xu, K. & Shi, Y. The spectrum model established for measuring the contents of Rebaudioside A and

Stevioside quickly in the leaves of _Stevia rebaudiana_ Bertoni. _Energy Procedia_ 5, 855–861, https://doi.org/10.1016/j.egypro.2011.03.151 (2011). Article  CAS  Google Scholar  * Makapugay,

H. C., Nanayakkara, N. P. D. & Kinghorn, A. D. Improved high-performance liquid chromatographic separation of the _Stevia rebaudiana_ sweet diterpene glycosides using linear gradient

elution, _J. Chromatogr_, 283, 390–395, 002 l-9673/84 (1984). * Livak, K. & Schmittgen, T. Analysis of relative gene expression data using real time quantitative PCR and the 2−ΔΔCT

method, _Methods_ 25, 402–408, 1046-2023/01 (2001). * Parris, C. A., Shock, C. C. & Qian, M. Dry leaf and steviol glycoside productivity of _Stevia rebaudiana_ in the Western United

States. _HortScience_ 51(10), 1220–1227, https://doi.org/10.21273/HORTSCI11149-16 (2016). Article  CAS  Google Scholar  * Pereira, C., Storck, L., Lopes, S. J., Martin, T. N. & Bisognin,

D. A. Dry biomass and glycosides yield from _Stevia rebaudiana_ leaves under different harvesting times. Bioscience. _Journal_ 32(6), 1462–1471, https://doi.org/10.14393/BJ-v32n6a2016-31574

(2016). Article  Google Scholar  * Yadav, A. K., Singh, S., Dhyani, D. & Ahuja, P. S. A review on the improvement of stevia [_Stevia rebaudiana_ (Bertoni)]. _Can. J. Plant Sci._ 91,

1–27, https://doi.org/10.14393/BJ-v32n6a2016-31574 (2011). Article  Google Scholar  * Gardana, C., Scaglianti, M. & Simonetti, P. Evaluation of steviol and its glycosides in _Stevia

rebaudiana_ leaves and commercial sweetener by ultra-highperformance liquid chromatography–mass spectrometry. _Journal of Chromatography A_ 1217, 1463–1470,

https://doi.org/10.1016/j.chroma.2009.12.036 (2010). Article  CAS  PubMed  Google Scholar  * Madhav, H., Salini, B. & Mohankumar, C. Functional and structural variation of uridine

diphosphate glycosyltransferase (UGT) gene of _Stevia rebaudianae_ UGTSr involved in the synthesis of rebaudioside A. _Plant Physiol. Biochem._ 63, 245–53,

https://doi.org/10.1016/j.plaphy.2012.11.029 (2013). Article  CAS  PubMed  Google Scholar  * Mohamed, A., Ceunen, S., Geuns, J., Ende, W. & Ley, M. UDP-dependent glycosyltransferases

involved in the biosynthesis of steviol glycosides. _Plant Physiology_ 168, 1136–1141, https://doi.org/10.1016/j.jplph.2011.01.030 (2011). Article  CAS  Google Scholar  * Behroozi, P.,

Baghizadeh, A., Saei, A. & Kharazm, S. Quantitative Analysis of Uridine Diphosphate Glycosyltransferase UGT85C2, UGT74G1 and UGT76G1 Genes Expression in _Stevia rebaudiana_ under

Different Irrigations. _Russian Journal of Plant Physiology_ 64(1), 67–72, https://doi.org/10.1134/S1021443717010034 (2017). Article  CAS  Google Scholar  * Zhang, S. S. _et al_. Mutations

in the uridine diphosphate glucosyltransferase 76G1 gene result in different contents of the major steviol glycosides in _Stevia rebaudiana_. _Phytochemistry_ 162, 141–147,

https://doi.org/10.1016/j.phytochem.2019.03.008 (2019). Article  CAS  PubMed  Google Scholar  * Francisco, F., Pereira, G. P., Machado, M. P., Kanis, L. A. & Deschamps, C.

Characterization of _Stevia rebaudiana_ Bertoni accessions cultived in southern Brazil. _J. Agric. Sci._ 10, 353, https://doi.org/10.5539/jas.v10n3p353 (2018). Article  Google Scholar 

Download references ACKNOWLEDGEMENTS The authors extend their sincere appreciation to the Deanship of Scientific Research at King Saud University for funding this research group (no. RG

1435-011). The authors thank the Deanship of Scientific Research and RSSU at King Saud University for their technical support. AUTHOR INFORMATION AUTHORS AND AFFILIATIONS * Agricultural

Botany Department, Faculty of Agriculture (Saba-Basha), Alexandria University, Alexandria, P.O. Box 21531, Bololky, Egypt Nader R. Abdelsalam & Ahmed E. Khaled * Department of Nucleic

Acids Research, Genetic Engineering & Biotechnology Research Institute (GEBRI), City for Scientific Research and Technology Applications, Alexandria, P.O. Box 21934, Egypt William A.

Botros * Sugar Crops Research Institute, Agricultural Research Center (ARC), Ministry of Agriculture, Alexandria, P.O. Box 21616, Egypt Mohamed A. Ghonema & Shimaa G. Hussein * Botany

and Microbiology Department, College of Science, King Saud University, P.O. Box 2455, Riyadh, 11451, Saudi Arabia Hayssam M. Ali & Mohamed S. Elshikh * Timber Trees Research Department,

Sabahia Horticulture Research Station, Horticulture Research Institute, Agriculture Research Center, Alexandria, P.O. Box 21616, Egypt Hayssam M. Ali Authors * Nader R. Abdelsalam View

author publications You can also search for this author inPubMed Google Scholar * William A. Botros View author publications You can also search for this author inPubMed Google Scholar *

Ahmed E. Khaled View author publications You can also search for this author inPubMed Google Scholar * Mohamed A. Ghonema View author publications You can also search for this author

inPubMed Google Scholar * Shimaa G. Hussein View author publications You can also search for this author inPubMed Google Scholar * Hayssam M. Ali View author publications You can also search

for this author inPubMed Google Scholar * Mohamed S. Elshikh View author publications You can also search for this author inPubMed Google Scholar CONTRIBUTIONS Nader R. Abdelsalam wrote the

main text of the paper, contributed to discussion of the results and prepared the tables and figures. William A. Botros performed DNA extraction, PCR and sequencing data analysis. Ahmed E.

Khaled designed the experimental work. Mohamed A. Ghonema provided the plant materials and performed the HPLC analysis. Shimaa G. Hussein performed DNA extraction, PCR and sequencing data

analysis. Hayssam M. Ali reviewed and edited the paper and prepared the tables and figures. Mohamed S. Elshikh reviewed the main text of the paper and designed the tables and figures.

CORRESPONDING AUTHOR Correspondence to Nader R. Abdelsalam. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing interests. ADDITIONAL INFORMATION PUBLISHER’S NOTE:

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. RIGHTS AND PERMISSIONS OPEN ACCESS This article is licensed under a

Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit

to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are

included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and

your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this

license, visit http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Abdelsalam, N.R., Botros, W.A., Khaled, A.E. _et al._ Comparison of

uridine diphosphate-glycosyltransferase UGT76G1 genes from some varieties of _Stevia rebaudiana_ Bertoni. _Sci Rep_ 9, 8559 (2019). https://doi.org/10.1038/s41598-019-44989-4 Download

citation * Received: 10 October 2018 * Accepted: 29 May 2019 * Published: 12 June 2019 * DOI: https://doi.org/10.1038/s41598-019-44989-4 SHARE THIS ARTICLE Anyone you share the following

link with will be able to read this content: Get shareable link Sorry, a shareable link is not currently available for this article. Copy to clipboard Provided by the Springer Nature

SharedIt content-sharing initiative