Atf3 negatively regulates cellular antiviral signaling and autophagy in the absence of type i interferons

ABSTRACT Stringent regulation of antiviral signaling and cellular autophagy is critical for the host response to virus infection. However, little is known how these cellular processes are

regulated in the absence of type I interferon signaling. Here, we show that ATF3 is induced following Japanese encephalitis virus (JEV) infection, and regulates cellular antiviral and

autophagy pathways in the absence of type I interferons in mouse neuronal cells. We have identified new targets of ATF3 and show that it binds to the promoter regions of _Stat1, Irf9_,

_Isg15_ and _Atg5_ thereby inhibiting cellular antiviral signaling and autophagy. Consistent with these observations, ATF3-depleted cells showed enhanced antiviral responses and induction of

robust autophagy. Furthermore, we show that JEV replication was significantly reduced in ATF3-depleted cells. Our findings identify ATF3 as a negative regulator of antiviral signaling and

cellular autophagy in mammalian cells, and demonstrate its important role in JEV life cycle. SIMILAR CONTENT BEING VIEWED BY OTHERS THE E3 LIGASE ASB3 DOWNREGULATES ANTIVIRAL INNATE IMMUNITY

BY TARGETING MAVS FOR UBIQUITIN-PROTEASOMAL DEGRADATION Article 12 September 2024 TRIM23 MEDIATES CGAS-INDUCED AUTOPHAGY IN ANTI-HSV DEFENSE Article Open access 13 May 2025 MODULATION OF

VIRUS-INDUCED NEUROINFLAMMATION BY THE AUTOPHAGY RECEPTOR SHISA9 IN MICE Article 20 April 2023 INTRODUCTION Viruses are arduous pathogens that pose a unique challenge to our immune system as

they are composed of the host-derived molecules. However, viral nucleic acids possess unique features distinguishing them from the host which have possibly led to the evolution of Pattern

Recognition Receptors (PRRs) for their detection. Among the PRRs, RIG-I-like receptors (RLRs) are ubiquitous cytosolic detectors which play an integral role in antiviral responses1.

Following the detection of viral infections, the PRR-initiated antiviral signaling rapidly induces the production of type 1 interferons (IFNa and IFNb) and other pro-inflammatory cytokines.

The IFNs once released into the extracellular milieu bind to their respective membrane-bound receptors and initiate downstream signaling leading to the modulation of expression of a cohort

of antiviral genes termed as Interferon Sensitive Genes (ISGs)2. The IFNs can potentially act in an autocrine or paracrine manner to subvert an existing viral infection or induce a

pre-emptive antiviral state, respectively. Both the primary response (PRR activation followed by IFN synthesis) and the secondary response (IFN- receptor interaction to modulate the ISG

expression) are driven by a dedicated family of transcription factors (TFs). The primary response is mainly driven by Interferon Regulatory Factor (IRF) family of TFs while the secondary

response depends on the activity of the STAT proteins as part of the JAK-STAT pathway3, 4. Binding of IFNs to their receptors leads to receptor dimerization followed by the activation of IRF

and STAT family of transcription factors. STAT1 and STAT2 dimerize and interact with IRF9 to form the Interferon-Stimulated Gene Factor 3 (ISGF3) complex5. This complex then translocates to

the nucleus and binds to the conserved Interferon-Stimulated Response Elements (ISREs) resulting in the induction of various ISGs. Apart from the induction of ISGs, type 1 IFN signaling

plays a pivotal role in regulating other cellular processes like autoimmunity6, cancer7 and autophagy8, 9. Autophagy is a highly conserved phenomenon in which cells digest their own

cytoplasmic content in the lysosomes. The term autophagy refers to the collection of various cellular processes including macroautophagy, microautophagy, chaperone-mediated autophagy and

non-canonical autophagy. Macroautophagy is the major route for degradation of cytoplasmic constituents where cellular components are sequestered within a double-membrane structure called

autophagosome, followed by its fusion with lysosomes. Autophagy is a tightly regulated phenomenon and its dysregulation results in various diseases. It has been reported that autophagy can

be regulated at both transcriptional and translational levels. Initially, Tor was shown to regulate autophagy in yeast10. It was reported that nutrient deprivation leads to phosphorylation

of TORC1 resulting in the inhibition of autophagy11. Apart from TORC1, several transcription factors have also been shown to regulate autophagy. It was observed that starvation leads to the

phosphorylation and activation of FOXO3 which then promotes autophagy via regulating family of ATG genes12, 13. Apart from FOXO family of transcription factors, autophagy has been shown to

be regulated by other transcription factors including E2F, NFKB and TP53. E2F family of transcription factors were shown to regulate autophagy directly via binding to some of the key

autophagy genes like _Lc3_, _Atg1_ and _Dram_ 14, 15. NFKB family of the transcription factor are well characterized for their role in inflammation. However, it was shown that there was an

inverse relation between autophagy and NFKB and both regulated each other positively. It was shown that while IKK complex leads to the induction of autophagy, functional autophagy was

required for the activation of NFKB16, 17. TP53, a well-known tumor suppressor, was shown to regulate autophagy in a dual manner depending on its location inside the cells. Its nuclear

location leads to the activation of autophagy whereas its cytoplasmic location leads to suppression of autophagy18, 19. Apart from regulation of autophagy by above-mentioned transcription

factors, a strong interplay between ATF3 and autophagy was recently reported where ATF3 was shown to regulate autophagy via beclin1 on the one hand, whereas on the other hand, autophagy was

shown to influence nuclear translocation of ATF320, 21. Activating Transcription Factor 3 (ATF3) belongs to the ATF/CAMP Responsive Element-Binding (CREB) family of TFs and is known to be

induced during inflammation and genotoxic stress22,23,24. ATF3 was shown to be induced by lipopolysaccharides (LPS) and regulate TLR4 signaling via epigenetic regulation. Furthermore, it was

shown that ATF3 interacts with HDAC1 thereby causing histone deacetylation and repression of the _Il6_ and _Il12b_ promoter22. Besides being a negative regulator of inflammatory responses,

ATF3 has been shown to positively regulate various cellular pathways suggesting that it can act either as an activator or repressor of transcription25, 26. Apart from the various TLR

ligands, ATF3 has also been shown to be induced by High-Density Lipoprotein (HDL), thus providing mechanistic insights into anti-inflammatory nature of HDL27. ATF3 has also been shown to

play an important role in inhibition of other cellular responses including the inhibition of allergen-induced airway inflammation in the mouse model of human asthma28. These studies thus

suggest that ATF3 can be induced by diverse pathways and act as a negative regulator of inflammation. Apart from regulating inflammatory responses, ATF3 has been recently shown to modulate

cellular antiviral signaling and autophagy20, 29. It is well established that viral infections lead to induction of primary and secondary type I IFN signaling. Recently, a role of type I

IFNs in the induction of autophagy was also reported8, 9. However, modulation of cellular antiviral signalling and autophagy in the absence of functional type I IFNs has not been studied.

Here, we have characterized the role of ATF3 in the regulation of cellular antiviral and autophagy signaling in neuronal cells, which we show are devoid of type I IFNs. Furthermore, we have

characterized the role of ATF3 in the life cycle of Japanese encephalitis virus (JEV), an RNA genome containing neurotropic flavivirus, that has been shown to signal via RIG-I30. We observed

that JEV infection of mammalian cells leads to a robust induction of ATF3. We demonstrate that ATF3 acts as negative regulator of cellular antiviral and autophagy signalling pathways. We

further show that ATF3 binds to the promoter region of _Stat1_, _Irf9, Isg15 and Atg5_ thereby uncovering a novel mechanism showing a direct role of ATF3 in the regulation of the antiviral

responses and autophagy in the absence of type I IFN signalling in JEV-infected neuronal cells. MATERIALS AND METHODS CELL LINES, VIRUS, AND ANTIBODIES Mouse neuroblastoma cells (Neuro2a),

porcine kidney stable cells (PS), human embryonic kidney cells (HEK293), and human cervical epithelial cells (HeLa) were obtained from the National Centre for Cell Sciences, Pune and

maintained in DMEM (Invitrogen) supplemented with 10% foetal bovine serum (FBS), penicillin/streptomycin and 2 mM glutamine. The P20778T strain of JEV grown in PS cells was used and titrated

by plaque formation on PS cells31. The P20778 strain of JEV was used in our studies. Rabbit polyclonal anti-ATF3 antibody (Cat. No. sc-188X) and anti-STAT1 antibody (Cat. No. sc-346) were

obtained from Santa Cruz, and rabbit polyclonal anti-JEV NS3 antibody was made in house. Rabbit monoclonal anti-GAPDH antibody (Cat. No. 2118), anti-LC3 antibody (Cat no 3868), anti-ATG5

antibody (Cat. No. 12994) and rabbit IgG (Cat. No. 2729) were procured from Cell Signalling Technology. MICROARRAY AND CHIP-SEQ DATA ANALYSIS To identify a putative genome-wide role of ATF3,

we integrated previously published whole genome occupancy profiling (ChIP-Seq) and transcriptome profiling (microarray) data. ChIP-Seq (ATF3) and microarray data in WT and ATF3 KO was

obtained from Gene Expression Omnibus (GEO) (IDs: ChIP-Seq: GSE36104; microarray: GSE32574). We used GEO2R utility to find out differentially expressed genes in KO condition over WT. Also,

we obtained the ATF3 binding sites from ChIP-Seq data (as submitted post peak calling on GEO) and identified the genes with a binding signal in +/− 10 kb of gene promoters. Also, we used the

sequence of binding sites to predict the binding motif of ATF3 using STEME32 and then scanned the obtained motif to identify other possible binding sites of ATF3. After that, we intersected

the two gene lists to identify genes that could be potentially regulated by ATF3. SIRNA TRANSFECTION ATF3 siRNA (Cat. No. L-058604) or non-targeting control siRNA (Cat. No. D-001810-10-20)

obtained from Dharmacon (ON-TARGET plus SMART pool) were transfected at a final concentration of 20 nM using DharmaFECT 1 following the manufacturers’ protocol. Briefly, 20 nmol siRNA was

complexed with 5 µl transfection reagent which was then added to the cell monolayer in a six-well plate in the presence of DMEM with 10% FBS. QUANTITATIVE REAL TIME PCR (QRT PCR) Total RNA

from cells was isolated using RNeasy kit (Qiagen) with in-column DNase digestion. Two hundred ng of total RNA was reverse-transcribed using random hexamers and ImProm-II reverse

transcription system (Promega). All qPCR were performed using 2x Fast SYBR-Green mix (Invitrogen) in ABI 7500 Fast RT-PCR machine (Applied Biosystems). For all experiments, _Gapdh_ levels

were used for normalization. List of primers used for quantifying the various gene transcripts is provided (Table 1). CHROMATIN IMMUNOPRECIPITATION (CHIP) Mock-infected or JEV-infected

Neuro2a cells (MOI 5) were trypsinized, washed and resuspended in 1 ml DMEM containing 10% FCS. Cells were fixed by adding 135 µl formaldehyde and incubation at 37 °C for 10 min followed by

the addition of 500 µl glycine (1.25 M) for 5 min. Following the cross-linking, cells were lysed, and chromatin was sheared using bioruptor (Diagenode). The complexes were then incubated

overnight with 5 µg ATF3 rabbit antibody and protein AG sepharose beads (20 µl). For the pull-down negative control, rabbit IgG was used. The beads were then washed extensively and incubated

at 70 °C for 15 min for reversal of cross-linking. DNA was then purified manually using the chloroform-phenol based method. For the PCR amplification of the _Stat1_ promoter sequence the

primers used were CTTCTTGCAGGCTTGGTTGAC (forward primer, FP) and GCGGGATTCAGAATTGGGGA (reverse primer, RP); for the _Irf9_ promoter PCR the primers were TTTCAGCGGCTCAGGTAAGA (FP) and

GAGCTGAAGAAATGGGCAGG (RP); for the _Isg15_ promoter PCR the primers were ACATCACTGGCACCATGACA (FP) and AGACAGCCACTTGTCTCCTC (RP); for the _Ifit1_ promoter the PCR primers used were

AGCCCCACTGTCTGTAGTTC (FP) and TGGGTCAGTGGTTAAGAGCA (RP); for the _Atg5_ promoter the PCR primers used were GAGCAACTCAGGTCTTGCCA (FP) and CTCGGAACCAGAGTGAACCG (RP); for the _Atg101_ promoter

the PCR primers used were GACGCACACATGGGATGACA (FP) and GGCTCTGGACTGAAGCACTC (RP); and for _Atg14_ promoter PCR primers used were AGTGCTGGCAGTGTGACTTG (FP) and GGGAACAGAAGTAAAGCCGGA (RP). A

negative control was employed to rule out the enrichment of DNA due to the non-specific binding to beads. For this, the following primers were designed on mouse gene desert on chromosome 5:

GATTGCAGAGTAAGATCCCTTGAT (FP) and GCGTAAGTTCTACATGCTGCTTTA (RP). One tenth of the input lysate employed for the pull-down was used as a positive control. The expected PCR product from

_Stat1, Irf9, Isg15, Ifit1, Atg5, Atg101, Atg14_ and the gene desert control was 236-, 260-, 283-, 206-, 142-, 150-, 115- and 124-bp, respectively. STATISTICAL ANALYSIS Statistical analysis

was performed using the Student’s t-test. The difference was considered significant at p < 0.05 and is indicated in the figures as *p < 0.05; **p < 0.01; ***p < 0.001. RESULTS

ATF3 IS INDUCED IN MAMMALIAN CELLS FOLLOWING JEV INFECTION ATF3 is known to be induced under the conditions of stress. Accordingly, we sought to study the transcriptional status of _Atf3_

during JEV infections. We found that _Atf3_ transcript was highly induced (>10-folds) following JEV infection of mouse neuronal cells (Neuro2a) and the levels of ATF3, as validated by

western blotting, increased as the virus replication progressed (Fig. 1a). The JEV-mediated induction of _Atf3_ was not cell-specific as similar observations were made in diverse cells like

human embryonic kidney (HEK) cells, human cervical epithelial (HeLa) cells, and mouse embryo fibroblast (MEF) cells (Fig. 1b). It may, however, be noted that the extent of ATF3 induction

following the virus infection varied greatly among the different cell lines perhaps due to the susceptibility of different cells to JEV infection. ATF3 induction following JEV infection

could be through multiple pathways including the TLR, RLR and UPR pathways24. We observed ~2-fold induction of ATF3 (Fig. 1c) when Neuro2a cells were treated with poly(IC) (induces TLR

pathway), triphosphate RNA (induces RLR pathway) as well as Thapsigargin (induces UPR pathway). While the levels of ATF3 were elevated >10-fold in JEV-infected Neuro2a cells,

UV-inactivated JEV failed to induce ATF3 synthesis. This suggested that JEV replication was necessary and various signalling pathways might have an additive effect towards the induction of

ATF3 during the viral infection. CHIP-SEQ AND MICROARRAY DATA IDENTIFIES ANTIVIRAL GENES POTENTIALLY REGULATED BY ATF3 We utilized computational biology approach to gain an insight into the

novel pathways that might be regulated by ATF3. Analysis of the ChIP-Seq data from mouse dendritic cells33 identified 12154 unique DNA sequences that could potentially bind ATF3. A

microarray-based study had identified a set of gene transcripts that were up-regulated in _Atf3_ knock-out (KO) mouse BMDM cells when compared with wild-type (WT) cells34. To obtain the

targets of ATF3, we overlaid the ATF3 ChIP-Seq data with the microarray data on the premise that this analysis may lead us to genes regulated by ATF3. We found 17 genes that showed ATF3

binding in ChIP-Seq study and were up-regulated in _Atf3_ KO cells (Table 2). A review of the known functions of these genes revealed a role in inflammation for many of them, with some of

them known to be ISGs (for example, _Ch25h, Rsg2_, and _Gbp8_) having a demonstrated antiviral role35, 36. Hypothesizing that ATF3 might be a regulator of the antiviral function; we scanned

the promoter region of various ISGs _in-silico_ which revealed that many ISGs had putative ATF3 binding sites in their promoter region (Table 3) suggesting that ATF3 might regulate the

antiviral function through a direct regulation of the various ISGs. ATF3 NEGATIVELY REGULATES VARIOUS ISGS Since robust ATF3 induction was observed during JEV infection, we sought to study

its role in cellular antiviral responses. The levels of various ISGs were studied post-JEV infection in Neuro2a cells where ATF3 levels had been knocked-down by siRNA (Fig. 2a). The siRNA

transfections were carried out in the presence of FBS, and cell viability was >95% as seen by Trypan blue staining, suggesting that siRNA transfection had no toxic effect. Out of the 36

antiviral genes studied, 25 showed a significantly increased (≥2.5-fold) transcript level in _Atf3_ siRNA-treated JEV-infected cells compared to control siRNA-treated cells. However, none of

the genes involved in the Unfolded Protein Response (UPR) pathway were affected suggesting that ATF3 specifically regulated the cellular antiviral pathway. Interestingly, levels of some of

the antiviral genes such as _Isg15, Mx1, Gbp1, Ifih1, Irf9, DDx60, Nlrp3, Bst2, Ifit1, Rig-I_ and _Casp1_ were significantly up-regulated (≥2.5-fold) in ATF3-depleted uninfected cells,

suggesting that ATF3 might be regulating the basal levels of these antiviral genes (Fig. 2b). We then studied the expression of some of the ISGs in Neuro2a cells following JEV infection at

different time points. In agreement with our previous findings, these data suggested that ATF3 negatively regulated the ISGs (Fig. 2c). ATF3 is known to positively regulate the _Chop/Ddit3_

transcript37. In agreement with the published data, our study showed a reduced level of this transcript in ATF3-depleted cells (Fig. 2c), thus validating our experimental setup and findings.

ATF3 DEPLETION INDUCES _STAT1, STAT2_ AND _IRF9_ TRANSCRIPTS ATF3 has been shown to directly repress the _Ifnb1_ promoter38. It can negatively regulate the expression of IFNs29, thereby

controlling the expression of various ISGs involved in antiviral function. Since neuronal cells are known to be deficient for IFN signalling39, an alternate mechanism must operate in these

cells for ATF3-mediated suppression of antiviral genes. STAT and IRF represent the family of TFs that regulates the expression of genes involved in primary and secondary immune responses,

respectively. Many of the ATF3-repressed genes described above are known to be under the regulation of TFs from these families. Therefore, it is possible that the enhancement of gene

expression observed upon _Atf3_ silencing is an indirect effect of up-regulation of genes from these TF families. We tested the transcript levels of multiple genes from STAT (_Stat1, Stat2,

Stat3, Stat4, Stat5a, Stat5b, Stat6_) and IRF family (_Irf1, Irf3, Irf9_) and found that only _Stat1, Stat2 and Irf9_ showed up-regulation in ATF3-depleted Neuro2a cells infected with JEV

(Fig. 3a). Interestingly, ATF3 was also found to regulate the basal levels of _Stat2_ and _Irf9_ in uninfected cells (Fig. 3a). STAT1 is a transcription factor which is a major regulator of

cellular antiviral response. We, therefore, performed western blotting of STAT1 to corroborate the above finding on its transcript. Indeed, we found a 3.8-fold enhanced expression of STAT1

in ATF3-depleted Neuro2a cells infected with JEV (Fig. 3b). It is well established that STAT1, STAT2 and IRF9 form the secondary response of type I IFN signalling which is initiated once

extracellular IFNs bind to their cognate receptors. Following the induction, STAT1, STAT2 and IRF9 assemble to form the ISGF3 complex that binds to the ISG elements in the promoter region to

regulate the expression of various antiviral genes. However, how the antiviral responses are regulated in cells devoid of type I IFN signalling needs further studies. There are conflicting

reports about the ability of neurons to produce IFN. For example, 2.5–3% of the hippocampal neurons in mice infected with Theiler’s virus and La Crosse virus produced IFN40, whereas dorsal

root ganglion neurons infected with herpes simples virus-1 failed to induce IFN mRNA39. We, therefore, sought to examine if Neuro2a cells produced IFN following the JEV infection. We found

no _Ifna4_ and _Ifnb1_ transcripts or secreted IFNb1 in Neuro2a cells, and these were still not detected at 24 h after JEV infection. However, _Ifna4_ and _Ifnb1_ transcripts and secreted

IFNb1 were found to be upregulated in MEF cells infected with JEV further confirming that neuronal cells are restricted in the production of type I IFNs (Fig. 3c). It can, thus, be

speculated that in neuronal cells, which are deficient in induction of type 1 IFNs, ATF3 may directly modulate the antiviral gene expression through ISGF3. We then checked the levels of

_Stat1, Stat2 and Irf9_ in IFN-sufficient, ATF3-depeleted MEF cells following JEV infection. We found that _Irf9_ transcript was significantly induced following JEV infection; however, the

transcript levels of _Stat1_and _Stat2_ were not affected (Fig. 3d). This may be related to the inhibition of STAT1 activation by JEV41, and therefore we studied the transcript levels of the

ISGF3 complex in the absence of ATF3 following the poly(IC) treatment. Here, we found that _Stat1, Stat2_ and _Irf9_ transcripts were significantly induced thereby supporting our hypothesis

(Fig. 3e). The data presented here thus suggest that the negative regulation of the type 1 IFN response via the regulation of the ISGF3 complex may be mediated through ATF3. ATF3 BINDS TO

_STAT1_ AND _IRF9_ PROMOTER Since the loss of ATF3 led to the induction of transcripts of ISGF3 complex, we sought to investigate the molecular mechanism for the observed phenomenon. ATF3

has been shown to bind the promoter region of its target gene thereby repressing it22. Analysis of promoter region had also revealed potential ATF3 binding sites in numerous ISGs suggesting

a direct regulation of ISGs by ATF3 (Table 3). We, therefore, performed chromatin immunoprecipitation (ChIP) to investigate if ATF3 could bind to the promoter region of various ISGs.

Compared to mock-infected cells at 24 h pi, _Stat1_ and _Irf9_ amplification product of 236- and 260-bp was clearly visible and enriched in JEV-infected cells when ATF3 antibody was used for

the pull-down (Fig. 4). However, an irrelevant IgG (negative control) failed to pull-down the desired product. Furthermore, under the same conditions, _Ifit1_ promoter having a putative

ATF3 binding site (Table 3) showed no enhanced binding to ATF3, suggesting that ATF3 specifically occupied the promoter regions of _Stat1_ and _Irf9_. These data clearly demonstrate that

ATF3 binds the promoter sequences of _Stat1_ and _Irf9;_ thereby suggesting that it could regulate the type 1IFN responses by regulating the ISGF3 complex. ATF3 BINDS TO _THE ISG15_ PROMOTER

ATF3 could also modulate the antiviral effect by directly controlling the expression of some of the classical ISGs. We had predicted the putative ATF3 binding site/s in _Isg15_ and a few

other classical ISG promoters (Table 3). Compared to mock-infected cells at 24 h pi, the _Isg15_ amplification product of 283-bp was clearly detected in JEV-infected cells when ATF3 rabbit

antibody was used for the pull-down in the ChIP assay (Fig. 4). These data show that ATF3 indeed binds to _Isg15_ promoter during the JEV infection of Neuro2a cells. ATF3 NEGATIVELY

REGULATES AUTOPHAGY IN THE ABSENCE OF TYPE I IFNS ATF3 induced in mice during cardiovascular stress was shown to regulate the autophagy20. We have recently shown that JEV infection induces

autophagy in Neuro2a42. Importantly, a role for IFN I in the induction of autophagy in various mammalian cells has been reported8. It was, therefore of interest to study what role ATF3 might

play in the induction of autophagy in Neuro2a cell shown to be deficient in IFN I synthesis. The effect of ATF3 depletion on JEV-induced autophagy was studied in Neuro2a by western blotting

the LC3-II protein, a marker for autophagy. We observed that the loss of ATF3 led to an enhanced autophagy during JEV infection of Neuro2a as well as MEFs, thus negating an essential role

of IFN I in ATF3-mediated autophagy in mammalian cells (Fig. 5a). This effect of ATF3 on autophagy was not specific to JEV infection since poly(IC)-induced autophagy in MEF cells was also

affected in a similar manner by ATF3 (Fig. 5b). Interestingly, we observed a spontaneous induction of autophagy in ATF3-depleted cells pointing towards a robust regulation of autophagy via

ATF3. These data show that ATF3 is a negative regulator of autophagy in mammalian cells. To further understand the ATF3-mediated regulation of autophagy, expression of several of the

autophagy-related genes was studied by the quantitative PCR of the RNA transcripts. ATF3 was found to regulate a battery of autophagy-related genes in Neuro2a cells in a negative manner

(Fig. 5c). Expression of some of these autophagy-related genes was consistently enhanced in JEV-infected Neuro2a cells at different time points in ATF3-depleted cells (Fig. 5d). In IFN I

sufficient MEF cells also ATF3 was found to downregulate the expression of autophagy-related genes in mock-treated, JEV-infected, or poly(IC)-treated cells (Fig. 5e–g). The repression of

autophagy-related genes by ATF3 was a specific action as ATF3 depletion resulted in suppression of _Ero1l_ gene that is involved in cellular UPR pathway but not known to have a role in

autophagy. These data clearly established that ATF3 negatively regulated autophagy in cells by inhibiting the expression of autophagy-related genes. ATF3 BINDS TO THE ATG5 PROMOTER The data

above showed a spontaneous induction of autophagy-related genes in the absence of ATF3, suggesting the possibility of direct control by the transcription factor ATF3. Scanning of the

promoter region of several autophagy-related genes revealed putative ATF3 binding site(s) (Table 4). Indeed, ATF3 was found to bind specifically to the promoter region of _Atg5_ in the ChIP

assay. Thus, compared to mock-infected cells at 24 h pi, _the Atg5_ amplification product of 142-bp was clearly visible and enriched in JEV-infected cells when ATF3 antibody was used for the

pull-down (Fig. 6). However, an irrelevant IgG (negative control) failed to pull-down the desired product. Importantly, despite having predicted ATF3 binding site, we did not see an

enrichment of _Atg101-_ or _Atg14-_specific PCR product, suggesting that ATF3 specifically occupied the promoter regions of _Atg5_. These data show that ATF3 binds the _Atg5_ promoter and

could control its expression. Indeed, ATF3 was shown to significantly suppress the expression of _Atf5_ transcripts in Neuro2a and MEF cells (Fig. 7). Accordingly, the level of ATG5 protein

was enhanced in ATF3-depleted Neuro2a cells (Fig. 7a). These data clearly show that the autophagy-related gene _Atg5_ is a direct transcriptional target of ATF3. ATF3 POSITIVELY REGULATES

JEV REPLICATION Loss of ATF3 led to robust induction of antiviral and autophagy pathways, and since both of these have antiviral effects, we investigated the role of ATF3 in JEV replication.

To this end, we studied virus replication in ATF3-depleted Neuro2a and MEF cells where a ~60% reduction in JEV RNA was seen in virus-infected cells (Fig. 8a). Concomitantly, the levels of

JEV NS1 protein were found to be reduced (Fig. 8b), and the viral yields were significantly suppressed by ~90% in ATF3-depleted Neuro2a and MEF cells (Fig. 8c). These data show that ATF3 is

a positive regulator of JEV replication in mammalian cells. DISCUSSION ATF3 is rapidly induced by a range of stress-causing cellular stimuli including ultraviolet radiation,

lipopolysaccharides, and cytokines, etc.24. Additionally, modulation of ATF3 has been observed in different host cells during diverse virus infections43,44,45. However, the role, if any, of

ATF3 in modulating cellular signalling pathways is not well understood. Here, using the data mining and computational biology approach we predicted ATF3 to be a negative regulator of

antiviral signalling. These observations were validated by genetic perturbation of ATF3 followed by JEV infection of mammalian cells. Our studies indicate that mammalian cells when infected

with JEV, showed a significant induction of ATF3. Interestingly we further observed that loss of ATF3 led to a substantial induction of ISGs even in the absence of type I IFN signalling.

Further investigation revealed that ATF3-mediated suppression of antiviral response in the absence of type I IFNs could be due to its ability to directly suppress _Stat1_ and _Irf9_ genes.

Previous studies have shown that ATF3 positively regulates _Stat1_ in mouse liver cells by binding to its promoter46, 47. In the present work, however, ATF3 was found to negatively regulate

_Stat1_ in mouse neuronal (Neuro2a) and fibroblast (MEF) cells. This phenomenon may, however, be attributed to the cell-specific role of ATF3, as it has been shown that ATF3 can act as a

transcriptional activator or a repressor depending on the cell type and the specific context under which it is induced. For example, ATF3 has been shown to negatively regulate IFN-gamma

production in NK cells, whereas it enhanced IFN-gamma production in CD4-positive cells43, 48. Various studies have identified ATF3 induction in response to cytokines, and our observation of

ATF3 regulating _Stat1_ and _Irf9_ suggests that ATF3 could act as a feedback regulator of type 1 IFN responses. Indeed, ATF3 was shown to bind to the _Ifnb1_ promoter thereby repressing it

in RAW264.7 cells38. Since antiviral responses are largely driven by type I IFNs, one can argue that hyper-induction of ISGs following JEV infection in the absence of ATF3 can be attributed

to enhanced IFNb1 production. However, in the present study, we show that ATF3 could modulate cellular antiviral and autophagy response in the absence of type I IFN signalling in neuronal

cells. Neurons have been reported to be restricted in the production of type I IFNs39. Confirming these reports; we also found a lack of IFNb1 secretion in Neuro2a cells post-JEV infection.

It was, therefore, intriguing to see robust induction of ISGs in these cells. The induction of antiviral responses despite the deficiency of type 1 IFN responses in Neuro2a cells points

towards an unexplored role of ATF3 in regulating antiviral responses. Data presented here show that ATF3 can bind the _Stat1_ and _Irf9_ promoter. ATF3 could thus regulate the ISGs through

direct regulation of ISGF3 complex. Recent reports show that ATF3 regulates the transcription of the gene encoding cholesterol 25-hydroxylase (_Ch25h_), a novel antiviral gene with an

important role in virus entry49. We also predicted ATF3 binding sites in the promoter region of several ISGs (Table 3) and observed ATF3 binding to _Isg15_ promoter using the ChIP assay. It

would, therefore, be of interest to further explore the direct regulation of ISGs by ATF3.As negative regulation of inflammatory responses is important to maintain cellular homeostasis, we

show in this study that ATF3 can act as a negative regulator of antiviral signaling via multiple nodes. Apart from the cellular antiviral signalling, various other cellular pathways have

been shown to have an antiviral effect. Previously we established the cellular autophagy as a negative regulator of JEV replication42. A defective autophagy has been shown to result in

perinuclear sequestration of ATF3 leading to increased inflammatory responses in _Atg4b_ KO mice, whereas in another report ATF3 was shown to regulate autophagy via Beclin1 pathway, thus

suggesting an interplay between autophagy and ATF320, 21. We observed enhanced autophagy in ATF3-depleted cells and found several autophagy-related genes to be highly induced following JEV

infection in ATF3-depleted neuronal cells. Further, we found the autophagy-related gene _Atg5_ as a transcriptional target of ATF3.There may be additional ATF3 targets among the

autophagy-related genes, as many of these had a putative ATF3 binding site but remain to be validated by ChIP assay. Cellular antiviral and autophagy responses are known to have antiviral

effects. Here, we show that ATF3 is a negative regulator of cellular antiviral and autophagy processes. Accordingly, ATF3 depletion led to a significant inhibition of JEV replication in

neuronal as well as fibroblast cells. Thus, induction of ATF3, leading to suppression of cellular antiviral and autophagy response, might be exploited by the virus to facilitate its life

cycle. Similar findings were made in the case of Lymphocytic Choriomeningitis virus (LCMV) which showed a marked reduction of virus replication in _Atf3_ KO BMDMs29. Interestingly, however,

Coxsackievirus B3 infection of HeLa cells caused suppression of ATF3 expression45. Interestingly, Coxsackievirus B3 has been shown to utilize cellular autophagy pathway for its efficient

replication suggesting that virus has evolved to inhibit ATF3, thereby inducing autophagy which is beneficial for its replication50. On the contrary, ATF3 expression was increased in the

livers of mice infected with Murine cytomegalovirus (MCMV) and a striking reduction in viral load was seen in the livers of _Atf3_ KO mice relative to WT mice which was attributed to

increased IFN-gamma in _Atf3_ KO mice43. In summary, we have presented evidence to show ATF3 as a negative regulator of antiviral response and autophagy in mammalian cells (Fig. 9) during

JEV infection thereby providing an advantage for the virus to propagate. Importantly, we provide evidence for the type I IFN-independent action of ATF3 in regulating the antiviral genes

using the _Stat1-Irf9_ axis and the regulation of the cellular autophagy through _Atg5_. This highlights the potential of targeting ATF3 for controlling the JEV replication, although the

important role of ATF3 in regulating the cytokine responses cannot be overlooked. REFERENCES * Goubau, D., Deddouche, S. & Reis e Sousa, C. Cytosolic sensing of viruses. _Immunity_ 38,

855–869 (2013). Article  CAS  PubMed  Google Scholar  * Sadler, A. J. & Williams, B. R. Interferon-inducible antiviral effectors. _Nat Rev Immunol_ 8, 559–568 (2008). Article  CAS 

PubMed  PubMed Central  Google Scholar  * Honda, K. & Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. _Nat Rev

Immunol_ 6, 644–658 (2006). Article  CAS  PubMed  Google Scholar  * Stark, G. R. & Darnell, J. E. Jr. The JAK-STAT pathway at twenty. _Immunity_ 36, 503–514 (2012). Article  CAS  PubMed

  PubMed Central  Google Scholar  * Schindler, C., Levy, D. E. & Decker, T. JAK-STAT signaling: from interferons to cytokines. _J Biol Chem_ 282, 20059–20063 (2007). Article  CAS  PubMed

  Google Scholar  * Hall, J. C. & Rosen, A. Type I interferons: crucial participants in disease amplification in autoimmunity. _Nat Rev Rheumatol_ 6, 40–49 (2010). Article  CAS  PubMed 

PubMed Central  Google Scholar  * Zitvogel, L., Galluzzi, L., Kepp, O., Smyth, M. J. & Kroemer, G. Type I interferons in anticancer immunity. _Nat Rev Immunol_ 15, 405–414 (2015).

Article  CAS  PubMed  Google Scholar  * Schmeisser, H. _et al_. Type I interferons induce autophagy in certain human cancer cell lines. _Autophagy_ 9, 683–696 (2013). Article  CAS  PubMed 

PubMed Central  Google Scholar  * Schmeisser, H., Bekisz, J. & Zoon, K. C. New function of type I IFN: induction of autophagy. _J Interferon Cytokine Res_ 34, 71–78 (2014). Article  CAS

  PubMed  PubMed Central  Google Scholar  * Noda, T. & Ohsumi, Y. Tor, a phosphatidylinositol kinase homologue, controls autophagy in yeast. _J Biol Chem_ 273, 3963–3966 (1998). Article

  CAS  PubMed  Google Scholar  * Long, X., Ortiz-Vega, S., Lin, Y. & Avruch, J. Rheb binding to mammalian target of rapamycin (mTOR) is regulated by amino acid sufficiency. _J Biol Chem_

280, 23433–23436 (2005). Article  CAS  PubMed  Google Scholar  * Sengupta, A., Molkentin, J. D. & Yutzey, K. E. FoxO transcription factors promote autophagy in cardiomyocytes. _J Biol

Chem_ 284, 28319–28331 (2009). Article  CAS  PubMed  PubMed Central  Google Scholar  * Xiong, X., Tao, R., DePinho, R. A. & Dong, X. C. The autophagy-related gene 14 (Atg14) is regulated

by forkhead box O transcription factors and circadian rhythms and plays a critical role in hepatic autophagy and lipid metabolism. _J Biol Chem_ 287, 39107–39114 (2012). Article  CAS 

PubMed  PubMed Central  Google Scholar  * Polager, S., Ofir, M. & Ginsberg, D. E2F1 regulates autophagy and the transcription of autophagy genes. _Oncogene_ 27, 4860–4864 (2008). Article

  CAS  PubMed  Google Scholar  * Tracy, K. _et al_. BNIP3 is an RB/E2F target gene required for hypoxia-induced autophagy. _Mol Cell Biol_ 27, 6229–6242 (2007). Article  CAS  PubMed  PubMed

Central  Google Scholar  * Criollo, A. _et al_. The IKK complex contributes to the induction of autophagy. _Embo J_ 29, 619–631 (2010). Article  CAS  PubMed  Google Scholar  * Criollo, A.

_et al_. Autophagy is required for the activation of NFkappaB. _Cell Cycle_ 11, 194–199 (2012). Article  CAS  PubMed  ADS  Google Scholar  * Green, D. R. & Kroemer, G. Cytoplasmic

functions of the tumour suppressor p53. _Nature_ 458, 1127–1130 (2009). Article  CAS  PubMed  PubMed Central  ADS  Google Scholar  * Maiuri, M. C. _et al_. Autophagy regulation by p53. _Curr

Opin Cell Biol_ 22, 181–185 (2010). Article  CAS  PubMed  Google Scholar  * Lin, H. _et al_. Activating transcription factor 3 protects against pressure-overload heart failure via the

autophagy molecule Beclin-1 pathway. _Mol Pharmacol_ 85, 682–691 (2014). Article  PubMed  Google Scholar  * Aguirre, A. _et al_. Defective autophagy impairs ATF3 activity and worsens lung

injury during endotoxemia. _J Mol Med (Berl)_ 92, 665–676 (2014). Article  CAS  Google Scholar  * Gilchrist, M. _et al_. Systems biology approaches identify ATF3 as a negative regulator of

Toll-like receptor 4. _Nature_ 441, 173–178 (2006). Article  CAS  PubMed  ADS  Google Scholar  * Whitmore, M. M. _et al_. Negative regulation of TLR-signaling pathways by activating

transcription factor-3. _J Immunol_ 179, 3622–3630 (2007). Article  CAS  PubMed  Google Scholar  * Hai, T., Wolfgang, C. D., Marsee, D. K., Allen, A. E. & Sivaprasad, U. ATF3 and stress

responses. _Gene Expr_ 7, 321–335 (1999). CAS  PubMed  Google Scholar  * Turchi, L. _et al_. Hif-2alpha mediates UV-induced apoptosis through a novel ATF3-dependent death pathway. _Cell

Death Differ_ 15, 1472–1480 (2008). Article  CAS  PubMed  Google Scholar  * Tanaka, Y. _et al_. Systems analysis of ATF3 in stress response and cancer reveals opposing effects on

pro-apoptotic genes in p53 pathway. _PLoS One_ 6, e26848 (2011). Article  CAS  PubMed  PubMed Central  ADS  Google Scholar  * De Nardo, D. _et al_. High-density lipoprotein mediates

anti-inflammatory reprogramming of macrophages via the transcriptional regulator ATF3. _Nat Immunol_ 15, 152–160 (2013). Article  PubMed  PubMed Central  Google Scholar  * Gilchrist, M. _et

al_. Activating transcription factor 3 is a negative regulator of allergic pulmonary inflammation. _J Exp Med_ 205, 2349–2357 (2008). Article  CAS  PubMed  PubMed Central  Google Scholar  *

Labzin, L. I. _et al_. ATF3 Is a Key Regulator of Macrophage IFN Responses. _J Immunol_ 195, 4446–4455 (2015). Article  CAS  PubMed  Google Scholar  * Kato, H. _et al_. Differential roles of

MDA5 and RIG-I helicases in the recognition of RNA viruses. _Nature_ 441, 101–105 (2006). Article  CAS  PubMed  ADS  Google Scholar  * Vrati, S., Agarwal, V., Malik, P., Wani, S. A. &

Saini, M. Molecular characterization of an Indian isolate of Japanese encephalitis virus that shows an extended lag phase during growth. _J Gen Virol_ 80(Pt 7), 1665–1671 (1999). Article 

CAS  PubMed  Google Scholar  * Reid, J. E. & Wernisch, L. STEME: efficient EM to find motifs in large data sets. _Nucleic Acids Res_ 39, e126 (2011). Article  CAS  PubMed  PubMed Central

  Google Scholar  * Garber, M. _et al_. A high-throughput chromatin immunoprecipitation approach reveals principles of dynamic gene regulation in mammals. _Mol Cell_ 47, 810–822 (2012).

Article  CAS  PubMed  Google Scholar  * Gold, E. S. _et al_. ATF3 protects against atherosclerosis by suppressing 25-hydroxycholesterol-induced lipid body formation. _J Exp Med_ 209, 807–817

(2012). Article  CAS  PubMed  PubMed Central  Google Scholar  * Schneider, W. M., Chevillotte, M. D. & Rice, C. M. Interferon-stimulated genes: a complex web of host defenses. _Annu Rev

Immunol_ 32, 513–545 (2014). Article  CAS  PubMed  PubMed Central  Google Scholar  * Warke, R. V. _et al_. Dengue virus induces novel changes in gene expression of human umbilical vein

endothelial cells. _J Virol_ 77, 11822–11832 (2003). Article  CAS  PubMed  PubMed Central  Google Scholar  * Jiang, H. Y. _et al_. Activating transcription factor 3 is integral to the

eukaryotic initiation factor 2 kinase stress response. _Mol Cell Biol_ 24, 1365–1377 (2004). Article  CAS  PubMed  PubMed Central  Google Scholar  * Cai, X., Xu, Y., Kim, Y. M., Loureiro, J.

& Huang, Q. PIKfyve, a class III lipid kinase, is required for TLR-induced type I IFN production via modulation of ATF3. _J Immunol_ 192, 3383–3389 (2014). Article  CAS  PubMed  Google

Scholar  * Yordy, B., Iijima, N., Huttner, A., Leib, D. & Iwasaki, A. A neuron-specific role for autophagy in antiviral defense against herpes simplex virus. _Cell Host Microbe_ 12,

334–345 (2012). Article  CAS  PubMed  PubMed Central  Google Scholar  * Delhaye, S. _et al_. Neurons produce type I interferon during viral encephalitis. _Proc Natl Acad Sci U S A_ 103,

7835–7840 (2006). Article  CAS  PubMed  PubMed Central  ADS  Google Scholar  * Lin, R. J., Chang, B. L., Yu, H. P., Liao, C. L. & Lin, Y. L. Blocking of interferon-induced Jak-Stat

signaling by Japanese encephalitis virus NS5 through a protein tyrosine phosphatase-mediated mechanism. _J Virol_ 80, 5908–5918 (2006). Article  CAS  PubMed  PubMed Central  Google Scholar 

* Sharma, M. _et al_. Japanese encephalitis virus replication is negatively regulated by autophagy and occurs on LC3-I- and EDEM1-containing membranes. _Autophagy_ 10, 1637–1651 (2014).

Article  PubMed  PubMed Central  Google Scholar  * Rosenberger, C. M., Clark, A. E., Treuting, P. M., Johnson, C. D. & Aderem, A. ATF3 regulates MCMV infection in mice by modulating

IFN-gamma expression in natural killer cells. _Proc Natl Acad Sci USA_ 105, 2544–2549 (2008). Article  CAS  PubMed  PubMed Central  ADS  Google Scholar  * Shu, M., Du, T., Zhou, G. &

Roizman, B. Role of activating transcription factor 3 in the synthesis of latency-associated transcript and maintenance of herpes simplex virus 1 in latent state in ganglia. _Proc Natl Acad

Sci USA_ 112, E5420–5426 (2015). Article  CAS  PubMed  PubMed Central  ADS  Google Scholar  * Hwang, H. Y. _et al_. Coxsackievirus B3 modulates cell death by downregulating activating

transcription factor 3 in HeLa cells. _Virus Res_ 130, 10–17 (2007). Article  CAS  PubMed  Google Scholar  * Kim, J. Y. _et al_. The induction of STAT1 gene by activating transcription

factor 3 contributes to pancreatic beta-cell apoptosis and its dysfunction in streptozotocin-treated mice. _Cell Signal_ 22, 1669–1680 (2010). Article  CAS  PubMed  Google Scholar  * Kim, J.

Y. _et al_. A critical role of STAT1 in streptozotocin-induced diabetic liver injury in mice: controlled by ATF3. _Cell Signal_ 21, 1758–1767 (2009). Article  CAS  PubMed  PubMed Central 

Google Scholar  * Filen, S. _et al_. Activating transcription factor 3 is a positive regulator of human IFNG gene expression. _J Immunol_ 184, 4990–4999 (2010). Article  CAS  PubMed  Google

Scholar  * Liu, S. Y. _et al_. Interferon-inducible cholesterol-25-hydroxylase broadly inhibits viral entry by production of 25-hydroxycholesterol. _Immunity_ 38, 92–105 (2013). Article 

PubMed  Google Scholar  * Harris, K. G. _et al_. RIP3 Regulates Autophagy and Promotes Coxsackievirus B3 Infection of Intestinal Epithelial Cells. _Cell Host Microbe_ 18, 221–232 (2015).

Article  CAS  PubMed  PubMed Central  Google Scholar  * Evonuk, K. S. _et al_. Inhibition of System Xc(−) Transporter Attenuates Autoimmune Inflammatory Demyelination. _J Immunol_ 195,

450–463 (2015). Article  CAS  PubMed  PubMed Central  Google Scholar  * Denda-Nagai, K. _et al_. Distribution and function of macrophage galactose-type C-type lectin 2 (MGL2/CD301b):

efficient uptake and presentation of glycosylated antigens by dendritic cells. _J Biol Chem_ 285, 19193–19204 (2010). Article  CAS  PubMed  PubMed Central  Google Scholar  * Ruzzo, E. K. _et

al_. Deficiency of asparagine synthetase causes congenital microcephaly and a progressive form of encephalopathy. _Neuron_ 80, 429–441 (2013). Article  CAS  PubMed  Google Scholar  *

Heikamp, E. B. _et al_. The AGC kinase SGK1 regulates TH1 and TH2 differentiation downstream of the mTORC2 complex. _Nat Immunol_ 15, 457–464 (2014). Article  CAS  PubMed  PubMed Central 

Google Scholar  * Miseta, A., Woodley, C. L., Greenberg, J. R. & Slobin, L. I. Mammalian seryl-tRNA synthetase associates with mRNA _in vivo_ and has homology to elongation factor 1

alpha. _J Biol Chem_ 266, 19158–19161 (1991). CAS  PubMed  Google Scholar  * Si, Y. _et al_. Growth differentiation factor 15 is induced by hepatitis C virus infection and regulates

hepatocellular carcinoma-related genes. _PLoS One_ 6, e19967 (2011). Article  CAS  PubMed  PubMed Central  ADS  Google Scholar  * Gibbons, D. L. _et al_. Cutting Edge: Regulator of G protein

signaling-1 selectively regulates gut T cell trafficking and colitic potential. _J Immunol_ 187, 2067–2071 (2011). Article  CAS  PubMed  PubMed Central  Google Scholar  * Nakano, I. _et

al_. Phosphoserine phosphatase is expressed in the neural stem cell niche and regulates neural stem and progenitor cell proliferation. _Stem Cells_ 25, 1975–1984 (2007). Article  CAS  PubMed

  Google Scholar  * Vestal, D. J. & Jeyaratnam, J. A. The guanylate-binding proteins: emerging insights into the biochemical properties and functions of this family of large

interferon-induced guanosine triphosphatase. _J Interferon Cytokine Res_ 31, 89–97 (2011). Article  CAS  PubMed  PubMed Central  Google Scholar  * Guo, M. _et al_.

Phosphatidylserine-specific phospholipase A1 involved in hepatitis C virus assembly through NS2 complex formation. _J Virol_ 89, 2367–2377 (2015). Article  PubMed  Google Scholar  *

Matsushima, A., Ogura, H., Koh, T., Shimazu, T. & Sugimoto, H. Enhanced expression of aquaporin 9 in activated polymorphonuclear leukocytes in patients with systemic inflammatory

response syndrome. _Shock_ 42, 322–326 (2014). Article  CAS  PubMed  Google Scholar  * Oliveira-Dos-Santos, A. J. _et al_. Regulation of T cell activation, anxiety, and male aggression by

RGS2. _Proc Natl Acad Sci USA_ 97, 12272–12277 (2000). Article  CAS  PubMed  PubMed Central  ADS  Google Scholar  * Shi, G. X., Harrison, K., Han, S. B., Moratz, C. & Kehrl, J. H.

Toll-like receptor signaling alters the expression of regulator of G protein signaling proteins in dendritic cells: implications for G protein-coupled receptor signaling. _J Immunol_ 172,

5175–5184 (2004). Article  CAS  PubMed  Google Scholar  Download references ACKNOWLEDGEMENTS VS was supported by the VRI award from the Translational Health Science and Technology Institute.

We would like to thank Dr. Sankar Bhattacharyya (VIDRC) for sharing reagents. Work was supported by the Department of Biotechnology, Govt. of India grant no. BT/MB/01/VIDRC/08 to SV. AUTHOR

INFORMATION AUTHORS AND AFFILIATIONS * Vaccine and Infectious Disease Research Centre, Translational Health Science and Technology Institute, Faridabad, 121001, India Vikas Sood, Kiran Bala

Sharma, Vishal Gupta, Manish Sharma, Utsav Sen, Manjula Kalia & Sudhanshu Vrati * CSIR-Institute of Genomics and Integrative Biology, Delhi, 110007, India Dhurjhoti Saha, Parashar

Dhapola & Shantanu Chowdhury * Tokyo Medical and Dental University, Tokyo, 113-0034, Japan Shigetaka Kitajima * Faculty of Biological Sciences, Academy of Scientific and Innovative

Research (AcSIR), New Delhi, 110025, India Parashar Dhapola & Shantanu Chowdhury * Regional Centre for Biotechnology, Faridabad, 121001, India Sudhanshu Vrati Authors * Vikas Sood View

author publications You can also search for this author inPubMed Google Scholar * Kiran Bala Sharma View author publications You can also search for this author inPubMed Google Scholar *

Vishal Gupta View author publications You can also search for this author inPubMed Google Scholar * Dhurjhoti Saha View author publications You can also search for this author inPubMed 

Google Scholar * Parashar Dhapola View author publications You can also search for this author inPubMed Google Scholar * Manish Sharma View author publications You can also search for this

author inPubMed Google Scholar * Utsav Sen View author publications You can also search for this author inPubMed Google Scholar * Shigetaka Kitajima View author publications You can also

search for this author inPubMed Google Scholar * Shantanu Chowdhury View author publications You can also search for this author inPubMed Google Scholar * Manjula Kalia View author

publications You can also search for this author inPubMed Google Scholar * Sudhanshu Vrati View author publications You can also search for this author inPubMed Google Scholar CONTRIBUTIONS

V.S. designed and performed the experiments, and wrote the first draft of the manuscript. K.B.S., M.S., U.S. performed Western blots; V.G. performed autophagy qPCR assays; D.S. helped in

ChIP experiments; P.D. analyzed ChIP-Seq and microarray data; S.K., S.C., M.K. provided reagents and reviewed the data; and, S.V. planned and supervised the study, wrote and finalized the

manuscript. CORRESPONDING AUTHORS Correspondence to Vikas Sood or Sudhanshu Vrati. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare that they have no competing interests.

ADDITIONAL INFORMATION PUBLISHER'S NOTE: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. RIGHTS AND PERMISSIONS

OPEN ACCESS This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or

format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or

other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in

the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the

copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Sood, V., Sharma, K.B.,

Gupta, V. _et al._ ATF3 negatively regulates cellular antiviral signaling and autophagy in the absence of type I interferons. _Sci Rep_ 7, 8789 (2017).

https://doi.org/10.1038/s41598-017-08584-9 Download citation * Received: 21 April 2017 * Accepted: 21 July 2017 * Published: 18 August 2017 * DOI: https://doi.org/10.1038/s41598-017-08584-9

SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable link is not currently available for this article. Copy to

clipboard Provided by the Springer Nature SharedIt content-sharing initiative