Viral pathogens hitchhike with insect sperm for paternal transmission

ABSTRACT Arthropod-borne viruses (arboviruses) can be maternally transmitted by female insects to their offspring, however, it is unknown whether male sperm can directly interact with the

arbovirus and mediate its paternal transmission. Here we report that an important rice arbovirus is paternally transmitted by the male leafhoppers by hitchhiking with the sperm. The

virus-sperm binding is mediated by the interaction of viral capsid protein and heparan sulfate proteoglycan on the sperm head surfaces. Mating experiments reveal that paternal virus

transmission is more efficient than maternal transmission. Such paternal virus transmission scarcely affects the fitness of adult males or their offspring, and plays a pivotal role in

maintenance of viral population during seasons unfavorable for rice hosts in the field. Our findings reveal that a preferred mode of vertical arbovirus transmission has been evolved by

hitchhiking with insect sperm without disturbing sperm functioning, facilitating the long-term viral epidemic and persistence in nature. SIMILAR CONTENT BEING VIEWED BY OTHERS ARBOVIRUSES

AND SYMBIOTIC VIRUSES COOPERATIVELY HIJACK INSECT SPERM-SPECIFIC PROTEINS FOR PATERNAL TRANSMISSION Article Open access 09 March 2023 QUALITY OVER QUANTITY: UNRAVELING THE CONTRIBUTIONS TO

CYTOPLASMIC INCOMPATIBILITY CAUSED BY TWO COINFECTING _CARDINIUM_ SYMBIONTS Article 05 February 2022 INFECTION PATTERN OF MALE-KILLING VIRUSES ALTERS PHENOTYPES IN THE TEA TORTRIX MOTH

_HOMONA MAGNANIMA_ Article 26 December 2024 INTRODUCTION Many devastating plant, animal, and human pathogens are vectored by arthropod insects1,2. For example, _Rice stripe virus_ (RSV)

transmitted by planthoppers has caused a serious agricultural threat in Asian rice-growing countries3, and Zika virus transmitted by mosquitoes has caused a recent public health threat in

Americas4. Frequently, arthropod-borne viruses (arboviruses) can be vertically transmitted to the vector progeny population to ensure survival during adverse conditions for horizontal

transmission5,6,7. Thus, vertical transmission is an important endemic maintenance mechanism for arboviruses in nature. Vertical virus transmission by insect vectors in nature may include

maternal or paternal transmission7,8,9,10. Maternal transmission of arboviruses through transovarial passage has been extensively investigated6,9,11,12,13,14, however, whether sperm-mediated

paternal virus transmission occurs remain undetermined. Oocytes accumulate a large quantity of cytoplasm that provide a room for viral infection, whereas sperms discard their cytoplasm

during spermatogenesis and transform into a streamlined shape with the small head consisting of condensed nucleus and the slender tail made of microtubule bundles for motility15. Therefore,

if arboviruses can be paternally transmitted via insect sperm, a possible target may be the outer membrane of the sperm. Considering the extremely streamlined sperm structure, viral

infection to the sperm head is expected to impair normal functioning of the sperm16,17,18. For example, the presence of human immunodeficiency virus in the human sperm and Zika virus in mice

sperm would damage sperm normal functioning16,17,18, and, thus, sperm-mediated paternal virus transmission may seem unlikely to occur. In this study, however, we demonstrate that a

preferred mode of parental virus transmission has been evolved by hitchhiking with the sperm of male insect vectors without disturbing sperm functioning in a leafhopper-borne plant reovirus.

More than 75% of plant viruses can be transmitted by aphids, leafhoppers, planthoppers, whiteflies, and other vectors in a persistent, semi-, or non-persistent manner, thereby providing

fertile ground for mechanistic studies on vector transmission5,7,19. The mechanisms for vertical transmission of persistent plant viruses between an infected female and its offspring through

transovarial passage have been demonstrated5,8,11,12,13,14. For example, we have determined that RSV, a tenuivirus, and _Tomato yellow leaf curl virus_, a begomovirus, exploit the existing

oocyte entry paths of vitellogenin to overcome transovarial transmission barriers in planthopper or whitefly vectors11,12. We also have shown recently that transovarial transmission of _Rice

dwarf virus_ (RDV), a plant reovirus, is mediated by the specific interaction of the viral capsid protein with the outer membrane protein of an obligate symbiotic bacterium of the vector

green rice leafhoppers20. _Rice gall dwarf virus_ (RGDV), also a plant reovirus, causes epidemic outbreaks and extensive rice yield losses in Asian rice-growing countries, and has long been

thought to be transmitted by a transovarial mechanism in green rice leafhoppers21,22,23,24. However, we observed recently that the percentage of transovarial transmission (~ 20%) in the main

vector of RGDV, the green rice leafhopper _Recilia dorsalis_, is much lower than the overall percentage (~ 80%) of vertical transmission24. Unlike RDV, RGDV virions encounter strong

barriers to enter the oocytes in female vectors for maternal transmission24. The significant disparity between the percentages for the vertical and maternal transmission suggested that RGDV

may have evolved to be paternally transmitted by male insects to the offspring. Here, we report that a high efficiency of sperm-mediated paternal transmission route of RGDV by male _R.

dorsalis_ occurs without affecting the fitness of male insects or their offspring, which may play a vital role in long-term maintenance and spread of RGDV in the field. RESULTS PATERNAL

TRANSMISSION OF RGDV THROUGH VECTOR GENERATIONS To explore whether RGDV can be paternally transmitted, we observed vertical transmission of RGDV from viruliferous (V+) male (♂) or female (♀)

_R. dorsalis_ reared under controlled greenhouse conditions (Fig. 1a). In the eggs laid by the individual V+♀ leafhoppers that mated with nonviruliferous (V−) ♂ leafhoppers, 22% were

positive for RGDV (Fig. 1b), consistent with our earlier observation24; in contrast, 73% were RGDV-positive of the eggs produced by V−♀ leafhoppers that mated with V+♂ (Fig. 1b), indicating

that paternal transmission is ~ 3.3 times as efficient as maternal transmission, similar to the efficiency of vertical transmission by field-caught leafhoppers (Fig. 1c). Interestingly, the

highest efficiencies of vertical transmission (82%) were observed in both laboratory-reared and field-caught leafhoppers when both parents were viruliferous (Fig. 1b, c). We then determined

the epidemiological significance of paternal virus transmission in the field. Over the past 30 years, viral disease caused by RGDV is always epidemic in the field in Southern China7,23,24.

During the winter months (November to March) in Guangdong, Southern China when rice plants are rarely present, the weed _Alopecurus aequalis_ becomes the primary habitat of rice leafhoppers

for up to two generations (Fig. 1d). Generally, RGDV infection in the weed _A. aequalis_ was never observed in the field during the winter months, though a very low rate of viral infection

in _A. aequalis_ occurred under laboratory conditions (Supplementary Table 1). Thus, the weed _A. aequalis_ was not a suitable reservoir for RGDV in the field. After the late-planted rice is

harvested, infected leafhoppers move to grass weeds and overwinter (Fig. 1d). The overwintering generations move to rice and spread the virus in warm areas where rice is planted in early

April (Fig. 1d). We surveyed the leafhopper populations in Guangdong for the presence of RGDV in winter for 4 consecutive years. Although the percentage of viruliferous leafhoppers dropped

following the transfer to _A. aequalis_, 20–30% of the overwintering leafhoppers carried RGDV in March of all 4 years when spring rice became available (Fig. 1e). Interestingly,

significantly higher percentages of male leafhoppers were viruliferous than females (Fig. 1f). Paternal transmission also remained more efficient than maternal transmission when examined for

three successive generations (Fig. 1g). These data indicate a pivotal role of paternal transmission in the overwintering of RGDV in the field. PATERNAL TRANSMISSION DOES NOT AFFECT

OFFSPRING FITNESS We then determined whether the efficient paternal virus transmission affected the fitness of male _R. dorsalis_ or their offspring. We found that V+ males exhibited no

significant differences in either mating (Fig. 2a) or survival (Fig. 2b) compared with V− males. Generally, one male can mate with around four virgin V− females in 3 days (Fig. 2a).

Interestingly, paternal transmission of RGDV had no significant deleterious effects on female fecundity, progeny egg development and hatching rates when compared the crossing between V−

female and V+ male with that of V− female and V− male (Fig. 2d). In contrast, V+ females died earlier than V+ males and produced eggs with severe developmental defects compared with that of 

V− females (Fig. 2b, d). The surviving offspring from maternal transmission were able to reach adulthood and transmit the virus as efficiently as the ones from paternal transmission

(Supplementary Figure 1a). Moreover, neither maternal nor paternal transmission affected the offspring sex ratios (Fig. 2c). Therefore, paternal transmission of RGDV would avoid the

deleterious effect of maternal transmission on viruliferous vector population, thus promoting viral transmission. Taken together, the above data suggest that paternal transmission of RGDV as

a preferred mode of vertical transmission has been evolved during the long-term virus–vector interactions. PATERNAL TRANSMISSION OF RGDV BY HITCHHIKING WITH THE SPERM We then investigated

whether the sperm-mediated paternal transmission of RGDV occurred in male _R. dorsalis_. Our immunofluorescence and electron microscopy revealed an association of dense RGDV particles with

the plasma membrane of sperm heads in the male reproductive system (Fig. 3a–f). We then used immunofluorescence microscopy to observe how RGDV hitchhiked a ride on the sperm to offspring.

RGDV was initially detected in the spermatheca of V− females at 3 days post mating with V+ males (Fig. 3g–i and Supplementary Table 2). Subsequently, virus-decorated sperms in the

spermatheca moved to the oviduct for fertilizing the mature eggs during ovulation (Fig. 3j–l and Supplementary Table 2). RGDV became detectable in the genital tract but not in the oocytes of

females even at 10 days post mating (Fig. 3m–o and Supplementary Table 2). Electron microscopy showed that virus-decorated sperms were present in the dissected spermatheca of V+ females

(Fig. 3p), confirming the transfer of virions from V+ males to V− females. Immunofluorescence assays revealed that RGDV circulated within V− females after mating with V+ males, and ~ 63% of

tested female intestines were infected at 10 days post mating (Supplementary Table 3). However, the virus was rarely observed in the oocytes, indicating that strong ovarian transmission

barrier occurred (Supplementary Table 3). Moreover, V+ females, which acquired virus by mating with V+ males could transmit RGDV to rice plants, and the transmission efficiency increased

with the time post mating (Supplementary Figure 1b). These observations provide direct evidence for the paternal transmission of RGDV by “hitchhiking” with the sperms in the _R. dorsalis_

male reproductive system to the spermatheca of females, from there the sperms move to the oviduct to fertilize the eggs passing through outwards to be deposited (Fig. 3q). INTERACTION OF

RGDV P8 AND HEPARAN SULFATE PROTEOGLYCAN We further determined how RGDV virions were associated with the plasma membrane of sperm heads. We detected the initial binding of purified RGDV

virions to the head of live sperm dissected from nonviruliferous _R. dorsalis_ after 5 min incubation (Fig. 4a). With longer incubation times, more virions accumulated on the sperm heads

(Fig. 4a). Similar in vitro binding of RGDV to live sperms was also detectable after incubation with the major outer capsid protein P8, but not with the minor outer capsid protein P2 of RGDV

(Fig. 4b, c and Supplementary Figure 2a, b). Furthermore, the specific binding to the head of live sperms was abolished by pretreatment with antibodies against intact virions or P8, but not

P2 (Fig. 4d). These results indicate that the major outer capsid protein P8 mediates the direct binding of RGDV virions to the sperm head. To identify the sperm attachment protein, RGDV P8

fused to glutathione-_S_-transferase (GST) was generated as bait to screen the sperm proteins extracted from _R. dorsalis_ (Supplementary Figure 3a). Mass spectrometry analysis of the pulled

down proteins identified 12 peptides with four different types mapped to heparan sulfate proteoglycan (HSPG) (Supplementary Figure 3b), a ubiquitous cell surface protein, which has been

exploited by many pathogens such as viruses, bacteria, and parasites for their initial attachment and subsequent cellular entry25,26. Here, we determined that _R. dorsalis_ HSPG was 3941

amino acids long and consisted of five domains (GenBank accession number MH060173) (Fig. 4e). The 12 identified peptides all targeted the third domain (domain III) of HSPG (Supplementary

Figure 3b). Yeast two-hybrid assay showed that RGDV P8 interacted only with the domain III of HSPG (Fig. 4f and Supplementary Figure 4a–f). The specific interaction between RGDV P8 and HSPG

domain III was also independently verified by GST pull-down assay (Fig. 4g). RT-qPCR and western blot assays revealed an enriched expression of HSPG in the male reproductive system compared

with the remaining tissues or the female reproductive system of _R. dorsalis_ (Supplementary Figure 5a–e). Specific HSPG antibodies recognition of the sperm head and testis, but not the

intestines, was also verified by immunofluorescence microscopy (Supplementary Figure 5f). We found that the expression of HSPG in the male reproductive system was significantly induced in

viruliferous leafhoppers (Fig. 4h, i). Furthermore, the colocalization of RGDV and HSPG on the head of sperm was readily detectable (Fig. 4j) and sperm binding by RGDV virions was strongly

reduced by pretreatment with purified HSPG-specific antibodies (Fig. 4k). Importantly, microinjecting dsRNA targeting HSPG mRNA into the newly emerged viruliferous male _R. dorsalis_ knocked

down the in vivo expression of HSPG, thereby inhibited the sperm binding by RGDV virions (Fig. 4l, m and Supplementary Figure 6), and reduced the accumulation of RGDV in the male

reproductive systems (Fig. 4n) and the subsequent paternal transmission of RGDV to offspring (Fig. 4o). It is clear that RGDV infection can trigger the enriched accumulation of HSPG in

vector male reproductive system to benefit its paternal transmission. Taken together, these data indicate that the specific binding of RGDV virions to the sperm head mediated by P8-HSPG

interaction has a key function in the paternal vertical transmission (Fig. 4p). PATERNAL TRANSMISSION OF RGDV BY MINOR LEAFHOPPER VECTOR In addition, we examined if this phenomenon also

occurred in minor vector of RGDV, the rice leafhopper _Nephotettix cincticeps_. We first observed that the viruliferous rates of natural _R. dorsalis_ and _N. cincticeps_ population in

Guangdong were ~ 58% and 5% during planting seasons, respectively (Fig. 5a). The acquisition efficiency of _N. cincticeps_ under experimental conditions was only 13%, whereas that of _R.

dorsalis_ was over 80% (Fig. 5b). In the eggs laid by the individual V+ female that mated with V− male of _N. cincticeps_, 18% were positive for RGDV (Fig. 5c); in contrast, 62% were

RGDV-positive of the eggs produced by V− female that mated with V+ male of _N. cincticeps_, indicating that paternal transmission is ~ 3.4 times as efficient as maternal transmission by _N.

cincticeps_, similar to the efficiency of paternal transmission by _R. dorsalis_ (Fig. 5c). Immunofluorescence microscopy also showed a close association of RGDV with the head surface of

sperms dissected from seminal vesicles of V+ males of _N. cincticeps_ (Fig. 5d). However, virus attachment to the sperm of the non-vector of RGDV, the wheat leafhopper _Psammotettix

alienus_, was not observed (Fig. 5d). Moreover, the amino-acid sequences of HSPG domain III between the two rice leafhoppers were only two amino acids difference, but they differed in ~ 40

amino acids from that of the non-vector _P. alienus_ (Fig. 5e). A yeast two-hybrid assay also indicated that RGDV P8 specifically interacted with HSPG domain III of _N. cincticeps_, rather

than with that of _P. alienus_ (Fig. 5f). Thus, exploiting HSPG for the efficient parental transmission of RGDV is a conserved mechanism in rice leafhopper vectors. DISCUSSION A handful of

studies have described the mechanistic basis of vertical maternal transmission of arboviruses and its role in epidemic persistence of viruses6,7,8, whereas the occurrence of vertical

paternal transmission in nature is undetermined. In this study, we discovered a previously unknown phenomenon: a rice arbovirus can be efficiently transmitted from male insect vectors to

offspring through a direct interaction of viral outer protein with the cell surface HSPG of the sperm head without affecting the fitness of male insects or their offspring. More importantly,

an infected male can potentially transfer viruses to more offspring because a male can mate repeatedly with females and thus enhance virus spread. By contrast, during maternal transmission,

viral propagation in the oocytes of female ovary often causes cytopathologic changes, decreasing the fitness of insect offspring24,27. Thus, males transmit a remarkably higher proportion of

viruses to insect offspring through sperms than females transmit through ovaries. Furthermore, viruliferous males survive much longer than viruliferous females, and finally, more males are

infected by RGDV than females in the field. More importantly, the paternal transmission rate (~ 60%) is evidently higher than the maternal rate (~ 20%) in field-collected _R. dorsalis_

populations. Thus, during the cold seasons unfavorable for virus-infected rice hosts in the field, the maintenance efficiency of RGDV through up to two insect generations tends to decrease.

We deduce that such a sperm-mediated paternal transmission is a more powerful type of vertical virus transmission than maternal transmission by insect vectors in many cases, and  plays a

vital role in the efficient maintenance of RGDV during the cold seasons in the field. Taken together, a preferred mode of vertical arbovirus transmission has been evolved by hitchhiking with

insect sperm, thereby explaining a natural long-term endemic pattern of RGDV throughout Southern China for > 30 years. At present, whether other vector-borne viral pathogens can be

carried by insect sperms and then be paternally transmitted with high efficiency in nature is as yet unknown. Interestingly, arboviruses such as La Crosse virus and Zika virus can be

paternally transmitted by male mosquitoes with low efficiency, but viral antigens were not observed within sperms9,28,29,30. It seems that La Crosse virus and Zika virus in mosquitoes can be

venereally transmitted by male accessory sex gland fluid rather than by sperm, which agrees with the findings for the symbiotic rhabdoviruses in _Drosophila_31. We cannot rule out the

possibility that paternal transmission of RGDV occurs not through sperm but through seminal fluid. However, even though RGDV can enter into female oocytes from the infected male seminal

fluid, it would encounter strong ovarian barriers24, and, thus it appears to be of a low level of occurrence and constitute a relatively minor component of the vertical transmission rate.

Given the widespread occurrence of long-term epidemic for RGDV in nature, the virus has gained an evolutionary advantage by hitchhiking with the insect sperm for vertical propagation. We

anticipate other arboviruses may have also evolved a similar strategy to ensure viral survival during adverse conditions for horizontal transmission. Our study reveals a mode of vertical

transmission of an arbovirus. Lack of virus-infected host plants in cold seasons presents a bottleneck for arbovirus transmission so that sperm-mediated paternal transmission in vector

populations may be critical to viral persistence in the field. Our data lay a foundation for further investigation of the mechanisms underlying paternal virus transmission and ecological

significance, and provide insights into the development of efficient approaches to attenuate viral epidemic by targeting sperm-mediated paternal transmission mechanism. METHODS CROSSING

EXPERIMENTS Four treatments of crossing were conducted for _R. dorsalis_ adults from a laboratory-reared colony and a field-caught colony, respectively. In each treatment, one newly emerged

adult female was crossed with one newly emerged adult male as follows: (i) V− female (V−♀) × V− male (V−♂); (ii) V+ female (V+♀) × V− male (V−♂); (iii) V− female (V−♀) × V+ male (V+♂); and

(iv) V+ female (V+♀) × V+ male (V+♂). The V− and V+ _R. dorsalis_ populations have been established in our laboratory (Supplementary Materials and Methods). Our preliminary test confirmed

that > 80% of insects contained RGDV in the viruliferous populations27. Thus, for laboratory-reared colony, the 5th instar nymphs were caught from V− or V+ _R. dorsalis_ populations and

reared separately in glass tubes until eclosion for crossing. Generally, the percentage of V+ _R. dorsalis_ populations caught from the areas where RGDV incidence was high was above 60%.

Thus, for field-caught colony, the individual 3rd or 4th instar nymphs of _R. dorsalis_ were caught directly from the rice fields where RGDV incidence was high or from virus-free rice fields

in Guangdong, China and reared separately in glass tubes until eclosion. For the mating procedure, the newly emerged potential V+ adults were chosen for mating one to one with the V− adults

in glass tubes containing one rice seedling for 5 days, and the seedling was replaced daily with a new one to avoid viral acquisition from plant hosts. At the end of the fifth day, the

potential V+ males in each of the tubes were collected for virus detection by real-time-polymerase chain reaction (RT-PCR) assay, and the females were left in each of the tubes to lay eggs

for another 5 days and the seedling in each tube was renewed daily. The potential V+ females were then collected for virus detection by RT-PCR assay. At 7 days after the removal of females,

the seedlings were dissected to collect eggs for RGDV detection by RT-PCR assay. For each of the four mating types in the three independent experiments with the laboratory-reared colony, the

number of eggs detected in each independent experiment was as follows: V−♀ × V−♂, _n_1 = 51, _n_2 = 65, _n_3 = 69; V+♀ × V−♂, _n_1 = 72, _n_2 = 72, _n_3 = 76; V−♀ × V+♂, _n_1 = 78, _n_2 = 

77, _n_3 = 81; V+♀ × V+♂, _n_1 = 51, _n_2 = 62, _n_3 = 72. For each of the four mating types in the three independent experiments with the field-caught colony, the number of eggs detected

was as follows: V−♀ × V−♂, _n_1 = 66, _n_2 = 66, _n_3 = 50; V+♀ × V−♂, _n_1 = 65, _n_2 = 66, _n_3 = 55; V−♀ × V+♂, _n_1 = 78, _n_2 = 77, _n_3 = 81; V+♀ × V+♂, _n_1 = 55, _n_2 = 62, _n_3 = 

84. IMMUNOFLUORESCENCE STAINING For visualizing viral infection to the male reproductive system, second instar nymphs of _R. dorsalis_ were fed on diseased rice plants for 2 days and then

transferred to non-infected rice seedlings. At different days after eclosion, the reproductive system from 30 males was excised, fixed, immunolabeled with virus-specific IgG conjugated to

rhodamine (virus-rhodamine) (0.5 μg/μl) and actin dye phalloidin-fluorescein isothiocyanate (FITC) (Invitrogen, cat. F432; 1:200), and then processed for immunofluorescence microscopy. For

visualizing viral association with sperm, mature sperms were excised from the seminal vesicles of V+ males and then smeared on poly-lysine-treated glass slides. The sperms were fixed and

immunolabeled with virus-rhodamine (0.5 μg/μl), and then stained with 4′,6-diamidino-2-phenylindole (DAPI) (Sigma, cat. D9542). For visualizing the virus in females after transfer from

males, virgin V− female adults were mated one on one with V+ male adults in individual glass tubes for 3 days. Males were then collected and confirmed for RGDV-positive by RT-PCR assay. The

reproductive system was excised from each of the 30 female adults at 3, 6, and 10 days after mating with the V+ males, and then immunolabled with virus-rhodamine (0.5 μg/μl) and

phalloidin-FITC (Invitrogen, cat. F432, 1:200) to visualize the route of viral transfer. ELECTRON MICROSCOPY The seminal vesicles of V+ male adult _R. dorsalis_ or the spermatheca of female

adult _R. dorsalis_ at 3 days after crossing with V+ males were excised, fixed with 2% v/v glutaradehyde and 2% v/v paraformaldehyde in posphate-buffered saline (PBS) for 2 h at room

temperature, and then postfixed with 1% w/v osmium tetroxide in PBS for 1 h at room temperature. The fixed samples were dehydrated in grade series of ethanol up to 100% and embedded in

Spurr’s resin (SPI Ltd). Sections were observed with a transmission electron microscope (H-7650, HITACHI). RGDV-SPERM BINDING IN VITRO Mature, live sperms from the seminal vesicles were

smeared on poly-lysine-treated glass slides, and then incubated with purified RGDV virions (0.01 μg/μl) for 5, 30, or 90 min For detecting the binding of P2 or P8 of RGDV with sperm in

vitro, His-tag-fused P2 or P8 was expressed in _Escherichia coli_ strain _Rosetta_, and the proteins were purified using nickel-nitrilotriacetic acid resin (Qiagen). Sperm smears were also

incubated with the purified proteins (0.5 μg/μl) for 60 min and then stained with P2- or P8-specific IgG conjugated to rhodamine, P2-rhodamine (0.5μg/μl) or P8-rhodamine (0.5 μg/μl),

respectively, and then processed for confocal microscopy. Alternatively, purified RGDV virions were pre-incubated with P2 or P8 antibodies (0.5 μg/μl) for 10 min, and then incubated with

live sperms. The samples were stained with virus-rhodamine and DAPI, and then processed for confocal microscopy. IDENTIFICATION OF SPERM PROTEINS THAT INTERACT WITH RGDV P8 RGDV P8 was used

as bait to screen the interacting proteins extracted from sperms of _R. dorsalis_ using a GST pull-down assay. In brief, the GST-fused P8 or GST was bound to GST-Sepharose 4B beads (GE) for

3 h at 4 °C. Sperms were collected from the seminal vesicles of the males, suspended in PBS and lysed by ultrasounds. Sperm lysates were then centrifuged at 15,000×_g_ for 15 min, and the

supernatants were incubated with GST or GST-P8 conjugated Sepharose beads for 4 h at 4 °C. After extensive wash of the column, bound proteins were eluted, and then the eluted proteins were

treated with dithiotreitol (1 mm) for 30 min followed by alkylation with iodoacetamide (50 mm) for 30 min The mixture was incubated with trypsin (1 μg/50 μg protein) (Promega) overnight,

centrifuged at 14,000 × _g_ for 2 min and the pellets were collected. Peptides were eluted into autosampler vials with 50 μl buffer (84% ACN in 0.5% acetic acid). Organic solvent was removed

in a SpeedVac concentrator and the final sample volume was adjusted with buffer (2% ACN in 0.1% TFA) to 12 μl. A nanoflow high performance liquid chromatography instrument (Thermo Fisher

Scientific) was coupled on-line to a Q Exactive (Thermo Fisher Scientific) with a nanoelectrospray ion source (Proxeon). The peptide mixture (5 μg) was loaded onto a C18-reversed phase

column (2-cm long, 100 μm inner diameter) and separated with a linear gradient of 4–100% buffer B (80% ACN and 0.5% acetic acid). Data processing was performed using MaxQuant v1.6.0.1

software. The experiment was replicated three times. Peptides identified specifically from GST-P8 bound proteins were selected for analysis. Around 12 peptides targeted HSPG were identified

in each replicate. We then used PCR, 5′ and 3′ RACE approaches to clone the full-length HSPG cDNA based on the transcriptome database of _R. dorsalis_. It was a unique gene in the

transcriptome database of _R. dorsalis_. The full-length cDNA (13,267 bp) of HSPG was obtained, and it contained five domains (I–V) (Supplementary Figure 3). YEAST TWO-HYBRID ASSAY

Interaction between HSPG of _R. dorsalis_, _N. cincticeps_ or _P. alienus_ and the major capsid protein P8 of RGDV was tested in a yeast two-hybrid assay (Y2H) using a DUALmembrane starter

kit (DUALsystems Biotech) according to the manufacturer’s manual. The P8 gene of RGDV was cloned into the bait vector pBT3-STE (PBT-STE-RGDV P8), and the five domain sequences of HSPG of _R.

dorsalis_ as well as HSPG domain III of _N. cincticeps_ and _P. alienus_ were cloned into the prey vector pPR3-N (pPR3-N-DoI, pPR3-N-DoII, pPR3-N-DoIII, pPR3-N-DoIV, and pPR3-N-DoV)

(Supplementary Table 4). The bait and prey plasmids were co-transformed into the yeast strain NMY51. Plasmids pBT3-STE-RGDV and pPR3-N, pBT3-STE and pPR3-N-DoIII were co-transformed to test

self-activation. Plasmids pBT3-STE and pOST1-Nubl (positive control) or pPR3-N (negative control) were used to cotransform NMY51. All transformants were grown on synthetic dropout

(SD)-Trp-Leu agar plates (SD-2) and SD-Trp-Leu-His-Ade agar plates (SD-4) for 3–4 days at 30 °C. To assay the expression of fusion proteins, each yeast extract of tranformant strain was

tested by western blot using an antibody against the LexA domain of the bait fusion protein (DUALsystems Biotech, cat. P06004, 1:500) or an antibody against HA Tag domain (DUALsystems

Biotech, cat. P06005, 1:500) of the prey fusion protein. PULL-DOWN ASSAY A GST pull-down assay was used to confirm the interaction between the protein encoded by the domain III fragment of

the HSPG gene and the P8 gene of RGDV. In brief, the domain III sequence of the HSPG gene was cloned into PGEX-3 for fusion with GST. The P8 gene of RGDV, P2 gene of RGDV and the GFP gene

were cloned into pBT30a for His-tag fusion (Supplementary Table 4). All recombinant proteins were expressed in _E. coli_ strain BL21. GST-HSPG-DoIII was incubated with glutathione-Sepharose

beads (Amersham) for 4 h at 4 °C, then the mixture was centrifuged for 5 min at 500 g, and the supernatant was discarded. His-P8, His-P2, or His-GFP was added to the beads, and the mixture

was incubated for 4 h at 4 °C. The beads were collected and washed with washing buffer (300mm NaCl, 10 mm Na2HPO3, 2.7 mm KCl and 1.7 m KH2PO4). Immunoprecipitated proteins were detected by

western blot with His-tagged antibodies (Sigma, cat. SAB4301134, 1:1000) and GST-tagged antibodies (Sigma, cat. SAB4200692, 1:1000) separately. KNOCKDOWN OF HSPG EXPRESSION IN _R. DORSALIS_

A DNA fragment spanning a 774-bp segment targeting HSPG domain III was amplified by PCR using forward primer 5′-_ATTCTCTAGAAGCTTAATACGACTCACTATAGG_GGCGTGCGACTGGTGTACTA-3′ and reverse primer

5′-_ATTCTCTAGAAGCTTAATACGACTCACTATAGGG_GAGTGTGAAGTGGTGCGTCTTG-3′, both possessing a T7 promoter (shown in italic) at the 5′ end. PCR products were used for the synthesis of dsRNAs targeting

HSPG domain III (dsHSPG) according to the protocol for the T7 RiboMAX Express RNAi System kit (Promega). The 630-bp segment of the GFP gene was used for in vitro dsRNA syntheses (dsGFP) as

the control (Supplementary Table 4)32. Second instar nymphs of _R. dorsalis_ were allowed to feed on RGDV-infected rice plants for 2 days, and then transferred to non-infected rice plants.

Newly emerged male adults were microinjected with 0.2 nl dsRNAs (0.02 μg/μl) with a Nanoject II Auto-Nanoliter Injector (Spring), and then placed on non-infected rice seedlings. Different

concentrations of the dsHSPGs were microinjected into newly emerged male adult leafhoppers, and the mortality of insects was assessed every day. For each concentration, 30 insects were

microinjected, and three replicates were performed. To measure the effects of dsRNA on the transcript levels of the P8 gene of RGDV and HSPG gene of _R. dorsalis_, the male reproductive

systems were excised from dsRNA-treated male adults at 5 days after microinjection, and then total RNAs were extracted using Trizol reagent (Invitrogen). The transcript levels of the P8 gene

of RGDV and HSPG gene were quantified by relative RT-qPCR assay with the SYBR Green PCR MasterMix kit (Promega) in a Mastercycler Realplex4 real-time PCR system (Eppendorf) in accordance

with the manufacturer’s instructions. Relative levels of gene expression were normalized to a housekeeping gene _elongation factor 1alpha_ gene (EF1, accession number AB836665) and estimated

by the 2−△△Ct (cycle threshold) method. A pool of 20 insects was used for each replicate, and the experiment was replicated three times. Furthermore, the total proteins were extracted from

dissected male reproductive systems of 40 dsRNA-treated leafhoppers. P8 and HSPG protein levels were analyzed by western blot assay using P8- and HSPG-specific IgGs, respectively. To

determine whether dsHSPG treatment inhibited paternal transmission, at 3 days after microinjection, one dsHSPG- or dsGFP-treated V+ virgin male was placed with one V− virgin female in a

glass tube containing a rice seedling for 3 days. Ten pairs were performed for each treatment. The male leafhoppers were then assayed for RGDV, and female leafhoppers were left in the tubes

for oviposition. The offspring of each cross (dsGFP-treated, _n_ = 136; dsHSPG-treated, _n_ = 111) were tested for RGDV by RT-PCR assay. STATISTICAL ANALYSES All data were analyzed with SPSS

(version 17.0; SPSS, USA). Percentage data were arcsine square root-transformed before analysis. Multiple comparisons of the means were conducted using a one-way analysis of variance

followed by Tukey’s honestly significant difference test at the _P_<0.05 significance level. Comparisons between two means were conducted using Student’s _t_ test. The data were

back-transformed after analysis in the text, figures, and tables. REPORTING SUMMARY Further information on experimental design is available in the Nature Research Reporting Summary linked to

this article. DATA AVAILABILITY The authors declare that all data supporting the findings of this study are available in the manuscript and its Supplementary Information files are available

from the corresponding authors upon request. REFERENCES * Eigenbrode, S. D., Bosque-Pérez, N. & Davis, T. S. Insect-borne plant pathogens and their vectors: ecology, evolution, and

complex interactions. _Annu. Rev. Entomol._ 63, 169–191 (2017). Article  Google Scholar  * Mayer, S. V., Tesh, R. B. & Vasilakis, N. The emergence of arthropod-borne viral diseases: a

global prospective on dengue, chikungunya and zika fevers. _Acta Trop._ 166, 155–163 (2017). Article  Google Scholar  * He, M., Guan, S. Y. & He, C. Q. Evolution of _Rice stripe virus_.

_Mol. Phylogenet. Evol._ 109, 343–350 (2017). Article  CAS  Google Scholar  * Liu, Y. et al. Evolutionary enhancement of Zika virus infectivity in _Aedes aegypti_ mosquitoes. _Nature_ 545,

482–486 (2017). Article  ADS  CAS  Google Scholar  * Hogenhout, S. A., Ammar, E. D., Whitfield, A. E. & Redinbaugh, M. G. Insect vector interactions with persistently transmitted

viruses. _Annu. Rev. Phytopathol._ 46, 327–359 (2008). Article  CAS  Google Scholar  * Sebastian, L., Paul, R. E. & Louis, L. Determinants of arbovirus vertical transmission in

mosquitoes. _PLoS Pathog._ 12, e1005548 (2016). Article  Google Scholar  * Wei, T. & Li, Y. Rice reoviruses in insect vectors. _Annu. Rev. Phytopathol._ 54, 99–120 (2016). Article  CAS 

Google Scholar  * Jia, D. et al. Vector mediated transmission of persistently transmitted plant viruses. _Curr. Opin. Virol._ 28, 127–132 (2018). Article  Google Scholar  * Watts, D.,

Pantuwatana, S., Defoliart, G., Yuill, T. M. & Thompson, W. H. Transovarial transmission of La Crosse virus (California encephalitis group) in the mosquito. _Aedes triseriatus. Sci._

182, 1140–1141 (1973). CAS  Google Scholar  * Longdon, B. & Jiggins, F. M. Paternally transmitted parasites. _Curr. Biol._ 20, 695–696 (2010). Article  Google Scholar  * Huo, Y. et al.

Transovarial transmission of a plant virus is mediated by vitellogenin of its insect vector. _PLoS Pathog._ 10, e1003949 (2014). Article  Google Scholar  * Wei, J. et al. Vector development

and vitellogenin determine the transovarial transmission of begomoviruses. _Proc. Natl Acad. Sci. USA_ 114, 6746–6751 (2017). CAS  PubMed  Google Scholar  * Grylls, N. E. Rugose leaf curl-a

new virus disease transovarially transmitted by the leafhopper _Austroagallla Torrida_. _Aust. J. Biol. Sci._ 7, 47–58 (1954). Article  CAS  Google Scholar  * Sylvester, E. S. Evidence of

transovarial passage of the _Sowthistle yellow vein virus_ in the aphid _Hyperomyzus lactucae_. _Virology_ 38, 440–446 (1969). Article  CAS  Google Scholar  * Dallai, R. & Afzelius, B.

A. Characteristics of the sperm structure in Heteroptera (Hemiptera, Insecta). _J. Morphol._ 164, 301–309 (1980). Article  Google Scholar  * Garolla, A. et al. Sperm viral infection and male

infertility: focus on HBV, HCV, HIV, HPV, HSV, HCMV, and AAV. _J. Reprod. Immunol._ 100, 20–29 (2013). Article  Google Scholar  * Ma, W. et al. Zika virus causes testis damage and leads to

male infertility in mice. _Cell_ 167, 1511–1524 (2016). Article  CAS  Google Scholar  * Govero, J. et al. Zika virus infection damages the testes in mice. _Nature_ 540, 438–442 (2016).

Article  ADS  CAS  Google Scholar  * Ng, J. C. & Falk, B. W. Virus-vector interactions mediating nonpersistent and semipersistent transmission of plant viruses. _Annu. Rev. Phytopathol._

44, 183–212 (2006). Article  CAS  Google Scholar  * Jia, D. et al. Insect symbiotic bacteria harbour viral pathogens for transovarial transmission. _Nat. Microbiol._ 2, 17025 (2017).

Article  Google Scholar  * Omura, T. et al. Rice gall dwarf, a new virus disease. _Plant Dis._ 64, 795–797 (1980). Article  Google Scholar  * Inoue, H. & Omura, T. Transmission of _Rice

gall dwarf virus_ by the green rice leafhopper. _Plant Dis._ 66, 57–59 (1982). Article  Google Scholar  * Fan, H. et al. Rice gall dwarf: a new virus disease epidemic in the west of

Guangdong province of south China. _Acta Phytopathol. Sin._ 13, 1–6 (1983). Google Scholar  * Liao, Z. et al. Virus-induced tubules: a vehicle for spread of virions into ovary oocyte cells

of an insect vector. _Front. Microbiol._ 8, 475 (2017). PubMed  PubMed Central  Google Scholar  * Chen, Y., Götte, M., Liu, J. & Park, P. W. Microbial subversion of heparan sulfate

proteoglycans. _Mol. Cells_ 26, 415–426 (2008). PubMed  Google Scholar  * Tiwari, V., Maus, E., Sigar, I. M., Ramsey, K. H. & Shukla, D. Role of heparan sulfate in sexually transmitted

infections. _Glycobiology_ 22, 1402–1412 (2012). Article  CAS  Google Scholar  * Chen, Y. et al. Adverse effects of rice gall dwarf virus upon its insect vector _Recilia dorsalis_

(Hemiptera: Cicadellidae). _Plant Dis._ 100, 784–790 (2016). Article  CAS  Google Scholar  * Thompson, W. H. & Beaty, B. J. Venereal transmission of La Crosse (California encephalitis)

arbovirus in _Aedes triseriatus_ mosquitoes. _Science_ 196, 530–531 (1977). Article  ADS  CAS  Google Scholar  * Li, C. X. et al. Vector competence and transovarial transmission of two

_Aedes aegypti_ strains to Zika virus. _Emerg. Microbes Infect._ 6, e23 (2017). PubMed  PubMed Central  Google Scholar  * Campos, S. S. et al. Zika virus can be venereally transmitted

between _Aedes aegypti_ mosquitoes. _Parasite Vector_ 10, 605 (2017). Article  Google Scholar  * Longdon, B., Wilfert, L., Obbard, D. J. & Jiggins, F. M. Rhabdoviruses in two species of

_Drosophila_: vertical transmission and a recent sweep. _Genetics_ 188, 141–150 (2011). Article  Google Scholar  * Lan, H. et al. Small interfering RNA pathway modulates persistent infection

of a plant virus in its insect vector. _Sci. Rep._ 6, 20699 (2016). Article  ADS  CAS  Google Scholar  Download references ACKNOWLEDGEMENTS We are grateful to Shouwei Ding for helpful

discussions and editorial assistance, to Shusheng Liu for comments on the manuscript. We thank Dr. Xifeng Wang from Chinese Academy of Sciences for providing the _P. alienus_ colony. This

work was supported by grants from National Natural Science Foundation of China (Grants 31730071, 31770166, 31870148, and 31870149) and National Key Research and Development Plan Foundation

(2016YFD0300707). AUTHOR INFORMATION Author notes * These authors contributed equally: Qianzhuo Mao, Wei Wu. AUTHORS AND AFFILIATIONS * Vector-borne Virus Research Center, Fujian Province

Key Laboratory of Plant Virology, Fujian Agriculture and Forestry University, Fuzhou, Fujian, 350002, China Qianzhuo Mao, Wei Wu, Zhenfeng Liao, Jiajia Li, Dongsheng Jia, Xiaofeng Zhang, 

Qian Chen, Hongyan Chen, Jing Wei & Taiyun Wei * State Key Laboratory for Ecological Pest Control of Fujian and Taiwan Crops and College of Life Science, Fujian Agriculture and Forestry

University, Fuzhou, 350002, China Qianzhuo Mao, Dongsheng Jia & Taiyun Wei Authors * Qianzhuo Mao View author publications You can also search for this author inPubMed Google Scholar *

Wei Wu View author publications You can also search for this author inPubMed Google Scholar * Zhenfeng Liao View author publications You can also search for this author inPubMed Google

Scholar * Jiajia Li View author publications You can also search for this author inPubMed Google Scholar * Dongsheng Jia View author publications You can also search for this author inPubMed

 Google Scholar * Xiaofeng Zhang View author publications You can also search for this author inPubMed Google Scholar * Qian Chen View author publications You can also search for this author

inPubMed Google Scholar * Hongyan Chen View author publications You can also search for this author inPubMed Google Scholar * Jing Wei View author publications You can also search for this

author inPubMed Google Scholar * Taiyun Wei View author publications You can also search for this author inPubMed Google Scholar CONTRIBUTIONS Q.M., W.W. and T.W. designed all experiments.

Q.M., Z.L., J.L., X.Z., Q.C. and H.C. performed crossing experiments, field investigation, and fitness measurement experiments. Q.M., Z.L. and D.J. performed the experiments for

immunofluorescence staining and electron microscopy. Q.M., W.W. and Z.L. performed the protein interaction experiments and found the role of HSPG. Q.M., W.W. J.W. and T.W. analyzed the data.

T.W. organized the project and wrote the manuscript. All authors read and approved the manuscript. CORRESPONDING AUTHORS Correspondence to Jing Wei or Taiyun Wei. ETHICS DECLARATIONS

COMPETING INTERESTS The authors declare no competing interests. ADDITIONAL INFORMATION JOURNAL PEER REVIEW INFORMATION: _Nature Communications_ thanks Grant Hughes, Veronique Brault, and the

other anonymous reviewers for their contribution to the peer review of this work. Peer reviewer reports are available. PUBLISHER’S NOTE: Springer Nature remains neutral with regard to

jurisdictional claims in published maps and institutional affiliations. SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION PEER REVIEW FILE REPORTING SUMMARY RIGHTS AND PERMISSIONS OPEN

ACCESS This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format,

as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third

party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the

article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright

holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Mao, Q., Wu, W., Liao, Z. _et al._

Viral pathogens hitchhike with insect sperm for paternal transmission. _Nat Commun_ 10, 955 (2019). https://doi.org/10.1038/s41467-019-08860-4 Download citation * Received: 19 June 2018 *

Accepted: 03 February 2019 * Published: 27 February 2019 * DOI: https://doi.org/10.1038/s41467-019-08860-4 SHARE THIS ARTICLE Anyone you share the following link with will be able to read

this content: Get shareable link Sorry, a shareable link is not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative