Loss of function of FIP200 in human pluripotent stem cell-derived neurons leads to axonal pathology and hyperactivity

FIP200 plays important roles in homeostatic processes such as autophagy and signaling pathways such as focal adhesion kinase (FAK) signaling. Furthermore, genetic studies suggest an

association of FIP200 mutations with psychiatric disorders. However, its potential connections to psychiatric disorders and specific roles in human neurons are not clear. We set out to

establish a human-specific model to study the functional consequences of neuronal FIP200 deficiency. To this end, we generated two independent sets of isogenic human pluripotent stem cell

lines with homozygous FIP200KO alleles, which were then used for the derivation of glutamatergic neurons via forced expression of NGN2. FIP200KO neurons exhibited pathological axonal

swellings, showed autophagy deficiency, and subsequently elevated p62 protein levels. Moreover, monitoring the electrophysiological activity of neuronal cultures on multi-electrode arrays

revealed that FIP200KO resulted in a hyperactive network. This hyperactivity could be abolished by glutamatergic receptor antagonist CNQX, suggesting a strengthened glutamatergic synaptic

activation in FIP200KO neurons. Furthermore, cell surface proteomic analysis revealed metabolic dysregulation and abnormal cell adhesion-related processes in FIP200KO neurons. Interestingly,

an ULK1/2-specific autophagy inhibitor could recapitulate axonal swellings and hyperactivity in wild-type neurons, whereas inhibition of FAK signaling was able to normalize the

hyperactivity of FIP200KO neurons. These results suggest that impaired autophagy and presumably also disinhibition of FAK can contribute to the hyperactivity of FIP200KO neuronal networks,

whereas pathological axonal swellings are primarily due to autophagy deficiency. Taken together, our study reveals the consequences of FIP200 deficiency in induced human glutamatergic

neurons, which might, in the end, help to understand cellular pathomechanisms contributing to neuropsychiatric conditions.

Multiple studies have associated FIP200 (FAK family kinase-interacting protein of 200 kDa, aka RB1CC1) with psychiatric disorders. Duplications affecting the FIP200 gene were reported in

children with developmental delay [1] and patients suffering from autism [2]. A de novo mutation causing a frameshift in the FIP200 gene was also reported in a schizophrenia patient [3].

Importantly, a large cohort study identified duplication of FIP200 as the most significantly over-represented risk factor for the development of schizophrenia [4]. A schizophrenia patient

carrying a de novo complete duplication resulting in overexpression of FIP200 was also reported recently [5]. These observations point to a significant role of FIP200 in the pathogenesis of

psychiatric disorders and call for studies into the role of this gene in the human central nervous system.

The human FIP200 gene is localized on chromosome 8q11, encoding a protein with 1594 amino acid residues. Early studies suggested that FIP200 binds to the kinase domain of FAK, and inhibits

its kinase activity [6, 7]. Later studies revealed that FIP200 also functions in macroautophagy (hereafter referred to as autophagy) [8, 9]. It forms dimers and contributes to the

organization of the ULK1 complex with its N-terminal domain, while its C-terminus forms a “claw” structure to capture receptor-labeled cargos for the autophagy machinery [10,11,12].

Deletion of FIP200 in mice leads to embryonic death at mid/late gestation associated with heart failure and liver degeneration [13]. Mice with neural-specific deletion of FIP200 show

cerebellar degeneration accompanied by progressive neuronal loss, spongiosis, and neurite degeneration [14]. FIP200 loss of function also impairs maintenance and differentiation of postnatal

neural stem cells within the subventricular zone, a phenotype that can be attributed to intracellular radical oxygen species dysregulation and microglia activation [15, 16]. Deletion of

FIP200 in Bestrophin 1-positive cells leads to a loss of photoreceptors and the degeneration of the retinal pigment epithelium [17]. While these studies point to broad biophysiological

implications associated with FIP200 loss of function in the nervous system, the roles of FIP200 in neuronal development and function remained largely elusive. However, such data are a

prerequisite for deciphering the molecular mechanisms by which FIP200 variants contribute to the pathogenesis of psychiatric disorders such as schizophrenia.

Here we set out to study the function of FIP200 in forebrain neurons derived from human pluripotent stem cells (hPSCs). We used CRISPR-Cas9-based genome editing to introduce FIP200 loss of

function mutations in hPSCs, and employed a transcription factor-based “forward-programming” approach to generate induced glutamatergic neurons (iGlutNs). We report the morphological and

electrophysiological consequences of FIP200 loss of function in these neurons, and explore how autophagy- and FAK-dependent pathways might mediate these alterations. We expect these results

to provide an important basis for further deciphering the role of FIP200 mutations in the pathogenesis of psychiatric disorders.

Two hPSC lines were used in the present study: an induced pluripotent stem cell line generated in-house from skin fibroblasts of a healthy Caucasian male (iLB-C14m-s11; abbreviated C14,

registered at hPSCreg® as UKBi017-A (https://hpscreg.eu/cell-line/UKBi017-A)), and the male human embryonic stem cell line WA01 (aka H1) obtained from the WiCell Research Institute

(Wisconsin, USA). hPSCs were cultured in plates coated with Matrigel (1:100 dilution, Corning, 354230) in an hPSC maintenance medium (StemMACS iPS-Brew XF, Miltenyi Biotec, 130104368). A

mycoplasma test was performed every 2 weeks. For genome editing, hPSCs were prepared to reach 80% confluency, dissociated with Accutase (Thermo Fisher, A11105), and 3 × 104 cells were

resuspended in 20 µL nucleofection solution (P3 Primary Cell 4D Nucleofector kit, Lonza, V4XP-3012) containing RNPs composed of the Alt-R HiFi CRISPR-Cas9 nuclease (IDT, 1081059) and the

cr::tracrRNA (Hs.Cas9.RB1CC1.1.AB: CAAGATTGCTATTCAACACC; Alt-R® CRISPR-Cas9 tracrRNA, IDT, 1072532). Nucleofection was performed with an Amaxa 4D Nucleofector (Lonza) using the program

CM150. Single-cell-derived colonies were manually isolated and expanded. For genotyping analyses, a PCR amplicon was generated using GoTaq® DNA Polymerase (Promega, M3001) with primers: Fwd,

5′-GGGGAAGGTTTTAGAGTGAAATT-3′ and Rev, 5′-GAAGGCAATGTGCACGCTCA-3′. PCR products were then send for Sanger sequencing (Microsynth Seqlab) as well as amplicon sequencing (GENEWIZ, Inc.).

Cultures maintained in Matrigel-coated 96-well-plates were fixed with 4% PFA (Sigma-Aldrich, 100496) for 12 min, blocked with PBS containing 10% FBS (Thermo Fisher, 10500064) and 0.1% Triton

X-100 (Sigma-Aldrich, T8787) for 1 h at room temperature, and then incubated with primary antibodies (anti-SOX2 mouse, 1:1000, R&D Systems MAB2018; anti-OCT4 rabbit, 1:500, Santa Cruz

sc-9081; anti-GABA rabbit, 1:1000, Sigma A2052; and anti-TUBB3 1:250 chicken, Millipore AB9354) in blocking buffer at 4 °C overnight. The cultures were then washed three times with PBS and

incubated with secondary antibodies (Alexa 488 goat anti-mouse IgG, 1:1000, Alexa 555 goat anti-chicken IgG, 1:500, and Alexa 647 goat anti-rabbit IgG, 1:500, all from Thermo Fisher) in

blocking buffer at room temperature for 1 h. The solution was replaced with 1 µg/mL DAPI (Thermo Fisher, D1306) in PBS for 3 min and then washed once with PBS. Imaging was then conducted

with an IN Cell Analyzer 2200 (GE Healthcare) and analyzed with ImageJ [18].

The iGlutNs were generated as previously described in detail [19]. To that end, doxycycline was applied for the induction of NGN2 expression at the hPSC stage. After eight days of induction,

the resulting iGlutNs were dissociated and cryopreserved as batches. For morphological analysis, iGlutNs were thawed and seeded on a confluent layer of inactivated mouse astrocytes at a

density of 5 × 104 cells/well in neuronal medium (Neurobasal Medium (Thermo Fisher Scientific, 21103-049), 2% B27 supplement (Thermo Fisher Scientific, 17504-044), 1% GlutaMax (Thermo Fisher

Scientific, 35050-38), and 10 ng/mL BDNF (Cell Guidance Systems, GFH1). For electrophysiological recordings, iGlutNs were seeded in Matrigel-coated 24-well plates with micro-electrode

arrays at a density of 3 × 104 cells/well, and 3 × 104 mouse astrocytes were added the next day. The co-cultures were maintained in neuronal medium supplemented with 1 µg/ml doxycycline and

0.5% FBS, and a half medium change was performed twice per week. For immunoblotting analyses, iGlutNs were seeded in Matrigel-coated six-well-plates at a density of 1 × 106 cells/well, and

cultured with astrocyte-conditioned neuronal medium supplemented with 1 µg/ml doxycycline while changing half of the medium twice per week. For long-term treatment with the FAK inhibitor

PF573228 (Tocris 3239) or the ULK1 inhibitor MRT68921 (Tocris 5780), compounds were added immediately after thawing of the neuronal cultures and replenished with each media change every 3–4

days.

Cultures were washed once with ice-cold PBS, scratched off in cold PBS, and centrifuged. The pellet was resuspended in cold RIPA buffer (Sigma-Aldrich, R0278) supplemented with 1:100 HALT

protease and phosphatase inhibitor (Thermo Fisher, 78442). The lysate was incubated on ice for 30 min while vortexing every 5 min and then centrifuged for 30 min with 16,100×g at 4 °C. The

protein concentration of the supernatant was determined using the Pierce BCA Protein Assay kit (Thermo Fisher, 23225). About 30 µg protein samples were mixed with NuPAGE™ LDS Sample Buffer

(Thermo Fisher, 84788) and loaded onto a 10% Bis-Tris gel (Thermo Fisher, NP0315BOX) for electrophoresis and then electroblotted onto a methanol-activated PVDF membrane (Bio-Rad

Laboratories, 1620177). Afterwards, the membrane was blocked for 1 h at room temperature in TBS-T buffer (25 mM Tris-Base, 150 mM NaCl, and 0.1% Tween-20) containing 5% milk powder (Carl

Roth, T145), and incubated with the primary antibody diluted in blocking buffer (anti-FIP200, 1:1000, Sigma-Aldrich SAB4200135; anti-GAPDH 1:1000, Santa Cruz sc47724; anti-p62 1:1000, Abnova

H00008878-M01; anti-Ubiquitin 1:200, Santa Cruz sc-8017; anti-PSD95, 1:1000, Thermo Fisher MA1064; anti-Synapsin1, 1:1000, Synaptic Systems 106103) overnight at 4 °C. The membrane was then

washed 3 times with TBS-T buffer and incubated with HRP-conjugated secondary antibodies (anti-mouse IgG, 1:1000, Cell signaling 7074; and anti-rabbit IgG, 1:1000, Cell signaling 7076) in

blocking solution for 1 h at room temperature. Luminata™ Classico/Crescendo/Forte (Merck Millipore) were used for chemiluminescence detection in a Chemidoc XRS system (Bio-Rad Laboratories).

Signal quantification was performed using the Image Lab software (Bio-Rad Laboratories).

For each well of a 96-well plate, 100 ng plasmid and 0.3 µL Fugene reagent (Promega, E2311) were mixed with 10 µL neuronal medium, incubated at room temperature for 10 min, and added to each

well. Two reporter plasmids were used in the present study. The autophagy reporter plasmid expressing rat LC3 fused to mRFP and EGFP under the control of a CMV promotor (ptfLC3), was

generated by Tamotsu Yoshimori et al. [20], and obtained via Addgene (#21074). To label individual neurons in dense cultures, a cassette expressing humanized renilla reniformis green

fluorescent protein (hrGFP) under the control of Doublecortin (DCX) promoter was cloned into a pMA vector. The hrGFP was amplified from a plasmid constructed by Su-Chun Zhang et al. [21] and

obtained from Addgene (#52344). The DCX promoter was amplified from a lentiviral construct created by Ladewig et al. [22], and the pMA vector was obtained from GeneArt (GeneArt AG).

Live fluorescence imaging was performed with a Leica live cell imaging system (Leica Microsystems) 7–10 days after the plasmid transfection. The plate was kept in a chamber with a

temperature at 37 °C and CO2 at 5%. Sholl analysis was performed using the Sholl Analysis plug-in for ImageJ [23]. Axonal swellings as well as the number of autophagosomes and autolysosomes

were counted manually.

For all electrophysiological recordings, cultures were maintained in 24-well MEA plates (M384-tMEA-24W, Axion BioSystems). Each well contains 16 electrodes arranged in a 4 × 4 grid covering

an area of 1.1 mm × 1.1 mm. The electrodes have a diameter of 50 µm and a center-to-center distance of 350 µm. A Maestro MEA EDGE system (Axion BioSystems) was used for electrophysiological

data acquisition. For recording, the plate was loaded into a chamber with the temperature maintained at 37 °C and CO2 at 5%. Raw data sets were recorded with the sampling rate at 12.5 kHz

and a bandpass between 0.1–2000 Hz. Online spike detection was performed with a threshold of six times the standard deviation. For the recording of spontaneous activities, the plate was

first loaded into the chamber and equilibrated for 20–30 min, and then recorded for 10 min. For acute pharmacological stimulation experiments, compounds of 20x working concentration were

added into cultures and recordings were performed after 10 min of equilibration. After treatment, cultures were washed three times with fresh medium and recorded again after 20–30 min of

equilibration. Recorded data sets were processed using the Navigator software (Axion BioSystems).

Astrocyte-neuronal co-cultures were washed three times with ice-cold PBS and biotinylated with 1 mg/ml sulfo-NHS-SS-biotin (Thermo Fisher, 21331) in cold PBS for 45 min. Following the

protein extraction steps described above, the supernatant was then used for streptavidin precipitation employing magnetic streptavidin beads (Thermo Fisher, 88817). After rotating overnight

at 4 °C, beads were washed with RIPA buffer and the final pellet was subjected to mass spectrometry. For mass spectrometry, PBS-washed beads were digested overnight at 37 °C with 1 μg

trypsin (Promega, V5111). Using the nanoelectrospray interface, resulting peptides were sprayed into a timsTOF Pro mass spectrometer (Bruker Daltonics). Raw data were processed using the

MaxQuant computational platform (v2.0.1.0). The peak list was searched against the canonical Uniprot database of Homo sapiens and Mus musculus (20370 and 17048 entries, October 2020).

Proteins were quantified across samples using the label-free quantification algorithm in MaxQuant as label-free quantification (LFQ) intensities. Gene ontology analysis of cellular

components was performed using g:Profiler [24]. LFQ intensities of each mapped protein were first normalized by subtracting the median intensity, then compared between genotypes with

Student’s t-test and corrected with the false discovery rate (FDR) method. T values from the t-test of each protein were also used for a gene set enrichment analysis (GSEA) using WebGestalt

2019. The GSEA was performed using enrichment category “gene ontology Biological Process noRedundant” and the significance level was set to FDR 20 axons from three independent experiments

were analyzed. Scale bar, 100 µm. Two-way ANOVA with Tukey–Kramer correction for post hoc paired comparisons. PA parental line, WS wild-type subclone, KO knock-out line. ***p