Erythrocyte glucose-6-phosphate dehydrogenase deficiency in poland — a study on the 563 and 1311 mutations of the g6pd gene

ABSTRACT Studies on the mutation 563T and silent mutation 1311T of the glucose-6-phosphate dehydrogenase (G6PD) gene in Poland were performed in 26 families affected with G6PD deficiency

classified — according to WHO — as group 2 G6PD deficiency. Both mutations were found in 19 families, including 17 of Polish origin. Mutation 563T alone was found in 1 Greek female. The

frequency of the silent mutation 1311T in Polish unaffected controls was 0.10. It is postulated that at least parts of the Polish (or Middle-Eastern European) and Mediterranean populations

are of a common origin. You have full access to this article via your institution. Download PDF SIMILAR CONTENT BEING VIEWED BY OTHERS PREVALENCE AND MOLECULAR CHARACTERIZATION OF

GLUCOSE-6-PHOSPHATE DEHYDROGENASE DEFICIENCY IN THE LUE ETHNIC GROUP OF NORTHERN THAILAND Article Open access 03 February 2021 GLUCOSE-6-PHOSPHATE DEHYDROGENASE DEFICIENCY IN THE HAN CHINESE

POPULATION: MOLECULAR CHARACTERIZATION AND GENOTYPE–PHENOTYPE ASSOCIATION THROUGHOUT AN ACTIVITY DISTRIBUTION Article Open access 13 October 2020 ENZYMATIC DIAGNOSIS OF POMPE DISEASE:

LESSONS FROM 28 YEARS OF EXPERIENCE Article Open access 08 November 2020 INTRODUCTION The red cell glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common, genetically determined,

enzymatic defect. It affects more than 200 million people world-wide [1]. The red cell G6PD gene is localized in the Xq28 region [2]. Over 300 G6PD variants are described in the literature,

and more than 50 mutations have been found in G6PD-deficient patients [3, 4]. One of the most common G6PD variants is a Mediterranean one; it has been observed in several countries. The main

clinical manifestation is a hemolytic crisis after ingestion of fava beans. The mutation of DNA depends on a cytosine-thymine exchange in position 563 of the G6PD gene (mutation 563T). This

creates a substitution of serine for phenylalanine in position 188 of the polypeptide chain [5]. In Poland, G6PD deficiency is observed very rarely, the incidence being about 0.1% [6].

According to a previous study by one of us [7], only 44 cases (37 males and 7 females) with G6PD deficiency were found in a group of 475 patients with hemolytic anemia of unknown etiology

seen during a period of 17 years. It is worth noting that in that group 19 patients revealed clinical manifestations of favism. Biochemical analysis of G6PD performed in 2 affected males was

characteristic of the Mediterranean-like variant [7]. The aim of the present study was to look for the C→T mutation at position 563 in the G6PD gene in DNA samples obtained from

G6PD-deficient patients or members of their families. We also searched for the silent C→T mutation involving nucleotide 1311 since both mutations often coexist in the affected South European

subjects [8–10]. MATERIALS AND METHODS DNA samples were obtained from 46 subjects of 36 families with G6PD deficiency. Of those, 36 subjects of 26 families belonged to the 2nd class of G6PD

deficiency according to the WHO classification [11]. The remaining 10 subjects with chronic nonspherocytic hemolytic anemia belonged to the 1st class of G6PD deficiency [11]. A control

group was composed of 20 unaffected women. DNA was isolated from peripheral blood leukocytes according to Kunkel et al. [12]. PCR was performed according to Kurdi-Haidar et al. [13], with

only minor modifications. A Perkin-Elmer apparatus and Perkin-Elmer AmpliTaq DNA polymerase were used. Oligonucleotides B (ACTCCCGAAGAGGGGTTCAAGG), J (CCAGCCTCCCAGGA-GAGAGGAAG), F

(TGTTCTTCAACCCCGAGGAGT) and M (AAGACGTCCAGGATGAGGTGATC), as well as restriction enzymes _Mbo_II and _Bcl_I, were purchased from Fermentas, Vilnius, Lithuania. A DNA fragment containing exons

VI and VII (fragment A) was amplified for 33 cycles (1 cycle consisting of 1 min at 94° C, 1 min at 58°C and 1 min at 72°C). Fragment A was digested with _Mbo_II during 1 h at 37 ° C, and

the digestion products were analyzed on a 2.5% agarose gel. Mutation 563T creates a new _Mbo_II restriction site, and characteristic fragments appear on the gel. A DNA fragment containing

parts of exons X and XI (fragment B) was amplified for 33 cycles (one cycle consisting of 1 min at 94°C, 1 min at 56°C and 1 min at 72°C). Fragment B was digested with _Bcl_I overnight at 54

° C, and the digestion products were analyzed on a 3% agarose gel. Mutation at position 1311 creates a new _Bcl_I restriction site. RESULTS The material and the results are presented in

table 1. Members of 22 out of 26 families revealed manifestations of favism. Cases of acute hemolytic anemia (AHA) were observed in 5 families; in 1 family (No. 22), cases of favism and AHA

coexisted. All male patients had severe G6PD deficiency and were therefore classified as belonging to class 2 G6PD deficiency [11]. Mutation 563T was detected in 20 families whose members

were affected either with favism (19 families) or AHA (1 family; No. 23). A combination of mutation 563T with silent mutation 1311T was found in 19 families. Only in 1 family (No. 19) was

mutation 563T not accompanied by the silent mutation 1311T. This was a Greek female whose parents originated from Syria and Albania. In 6 families (No. 15, 16, 22, 24, 25 and 26) out of 23

Polish families affected either with favism or with AHA, mutation 563T was not present. All female heterozygotes, except 1, revealed some (normal or slightly decreased) G6PD activity. Only 1

female had undetectable G6PD activity, like all hemizygotic males. This female, although heterozygotic for mutation 563T, was homozygotic for mutation 1311T (No. 3 in table 1). In families

of Polish origin, mutation 563T, if present, always coexisted with the silent one 1311T; all 17 are presented in table 1. In a control group of 20 unaffected Polish females (without mutation

563T), the silent mutation 1311T was present in 4 out of 40 chromosomes (10%). None of the 10 subjects with chronic nonspherocytic hemolytic anemia revealed mutations 563T or 1311T (results

not presented in table 1). DISCUSSION The presented material contains most cases of G6PD deficiency ever reported or recognized in Poland. As we were able to show, favism in the Polish

population is mainly due to mutation 563T (G6PD Mediterranean) and is accompanied by the silent mutation 1311T. This coexistence of both mutations is very characteristic of the Mediterranean

populations and is not observed in countries of the Far East [10, 14, 15]. Our observation may indicate that it is also characteristic of the Middle-Eastern European population and suggests

a common origin of part of the Polish (or Middle-Eastern European) and Mediterranean populations. As mentioned above, the only female with undetectable G6PD activity was heterozygotic for

mutation 563T and homozygotic for the silent mutation 1311T. It is interesting to note that a similar case has been reported by Kurdi-Haidar et al. [13]. REFERENCES * Beutler E:

Glucose-6-phosphate dehydrogenase deficiency. N Eng J Med 1991;324:169–174. Article  CAS  Google Scholar  * Pai GS, Sprenkle JA, Do TT, Mareni CE, Migeon BR: Localization of loci for

hypoxanthine phosphoribosyltransferase and glucose-6-phosphate dehydrogenase and biochemical evidence of nonrandom X chromosome expression from studies of human X-autosome translocation.

Proc Natl Acad Sci USA 1980;77: 2810–2813. Article  CAS  Google Scholar  * Beutler E: Study of glucose-6-phosphate dehydrogenase. History and molecular biology. Am J Hematol 1993;42:53–58.

Article  CAS  Google Scholar  * Vulliamy T, Beutler E, Luzzatto L: Variants of glucose-6-phosphate dehydrogenase are due to missense mutations spread throughout the coding region of the

gene. Hum Mutat 1993;2: 159–167. Article  CAS  Google Scholar  * Vulliamy TJ, D’Urso M, Battistuzzi G, Estrada M, Foulkes NS, Martini G, Calabro V, Poggi V, Giordano R, Town M, Luzzatto L,

Persico MG: Diverse point mutations in the human glucose-6-phosphate dehydrogenase gene cause enzyme deficiency and mild or severe hemolytic anemia. Proc Natl Acad Sci USA 1988;85:

5171–5175. Article  CAS  Google Scholar  * Hanke J, Kuczyński T, Linkowska R: Próba oceny czȩstości występowania niedoborów G6PD w krwince czerwonej w populacji polskiej. (Frequency of the

erythrocyte glucose-6-phosphate dehydrogenase deficiency in Polish population — a trial of evaluation). Med Pr 1968;19:532–536. Google Scholar  * Jabłońska-Skwiecińska E: Niedobory

enzymatyczne krwinek czerwonych i ich rozpoznawanie w świetle własnych badań. (Red cell enzymatic deficiencies and their diagnosis in the light of own studies). Warszawa, CMKP, 1991. Google

Scholar  * Frigerio R, Sole G, Lovicu M, Passiu G: Molecular and biochemical data on some glucose-6-phosphate dehydrogenase variants from southern Sardinia. Haematologica 1994;79:319–321.

CAS  PubMed  Google Scholar  * Vives-Corrons JL, Kuhl W, Pujades MA, Beutler E: Molecular genetics of the glucose-6-phosphate dehydrogenase (G6PD) Mediterranean variant and description of a

new G6PD mutant, G6PD Andalus1361A. Am J Hum Genet 1990;47:575–579. CAS  PubMed  PubMed Central  Google Scholar  * Beutler E, Kuhl W: The NT 1311 polymorphism of G6PD. G6PD Mediterranean

mutation may have originated independently in Europe and Asia. Am J Hum Genet 1990;47: 1008–1012. CAS  PubMed  PubMed Central  Google Scholar  * WHO Working Group: Glucose-6-phosphate

dehydrogenase deficiency. Bull World Health Organ 1989;67:601–611. Google Scholar  * Kunkel LM, Smith KD, Boyer SH, Borgaonkar DS, Wachtel SS, Miller OJ, Breg WR, Rary JM: Analysis of human

Y-chromosome-specific reiterated DNA in chromosome variants. Proc Natl Acad Sci USA 1977;74:1245–1249. Article  CAS  Google Scholar  * Kurdi-Haidar B, Mason PJ, Berrebi A, Ankra-Badu G,

Al-Ali A, Oppenheim A, Luzzatto L: Origin and spread of the glucose-6-phosphate dehydrogenase variant (G6PD-Mediterranean) in the Middle East. Am J Hum Genet 1990;47: 1013–1019. CAS  PubMed

  PubMed Central  Google Scholar  * Saha N, Ramzan M, Tay JSH, Low PS, Basair JB, Khan FM: Molecular characterisation of red cell glucose-6-phosphate dehydrogenase deficiency in N-W

Pakistan. Hum Hered 1994; 44:85–89. Article  CAS  Google Scholar  * Saha S, Saha N, Tay JSH, Jeyaseelan K, Basair JB, Chew SE: Molecular characterisation of red cell glucose-6-phosphate

dehydrogenase deficiency in Singapore Chinese. Am J Hematol 1994;47:273–277. Article  CAS  Google Scholar  Download references ACKNOWLEDGEMENTS This work was supported by grant W-PDL-3/95

from the Medical Center of Postgraduate Education, Warsaw, Poland. AUTHOR INFORMATION AUTHORS AND AFFILIATIONS * Department of Laboratory Diagnostics, Medical Center of Postgraduate

Education, ul. Banacha 1a 02-097, Warszawa, Poland Ewa Jabłońska-Skwiecińska MD & Jolanta Kłopocka * Department of Genetics, Institute of Psychiatry and Neurology, Warsaw, Poland Janusz

G. Zimowski, Mariola Bisko, Dorota Hoffman-Zacharska & Jacek Zaremba Authors * Ewa Jabłońska-Skwiecińska MD View author publications You can also search for this author inPubMed Google

Scholar * Janusz G. Zimowski View author publications You can also search for this author inPubMed Google Scholar * Jolanta Kłopocka View author publications You can also search for this

author inPubMed Google Scholar * Mariola Bisko View author publications You can also search for this author inPubMed Google Scholar * Dorota Hoffman-Zacharska View author publications You

can also search for this author inPubMed Google Scholar * Jacek Zaremba View author publications You can also search for this author inPubMed Google Scholar RIGHTS AND PERMISSIONS Reprints

and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Jabłońska-Skwiecińska, E., Zimowski, J.G., Kłopocka, J. _et al._ Erythrocyte Glucose-6-Phosphate Dehydrogenase Deficiency in Poland — a

Study on the 563 and 1311 Mutations of the G6PD Gene. _Eur J Hum Genet_ 5, 22–24 (1997). https://doi.org/10.1007/BF03405873 Download citation * Received: 28 June 1996 * Revised: 22 November

1996 * Accepted: 16 December 1996 * Issue Date: January 1997 * DOI: https://doi.org/10.1007/BF03405873 SHARE THIS ARTICLE Anyone you share the following link with will be able to read this

content: Get shareable link Sorry, a shareable link is not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative KEY

WORDS * G6PD deficiency * Favism in Poland * Mutation 563T * Mutation 1311T